ORFeome > mrps16 ORF1 – XORFeome v1.0

mrps16 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mrps16
Gene ID: 5805304
Gene Page ID: 5805276
ORF Xenbase ID: 17284857

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124965
Original XGC clone length: 420

Human orthology & disease relationships

NCBI Entrez ID: 51021
Ensembl gene IDs: ENSG00000182180
Directly associated (OMIM) disease MIM numbers: 610498
Indirectly associated (Lage, et al.) disease MIM numbers: 264070,606952,608323

Library Location

Plate ID: GDExl11084
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ837483
dbEST ID: 79655185
Trimmed Sequence: ATGGTTCATTTAACATCTCAGCTTTTGAAACGATATTATGGAGGACATGTTGCAATCCGACTGGCACTGGGTGGTTGTGCCAATAGGCCTTTCTATCGTGTTGTCGCTGCTCATAACAAGCGAGCAAGGGACGGAAAATTCTTAGAACAACTTGGCACATATGATCCAATGCCCAACATCTACAACGAAAAACTCGTCAGCCTAAATATTGAGAAAATCAAATACTGGATTGGCTGCGGAGCACATACTACAAAACCAGTTGCAAAGTTACTAGGCCTTGCAGGATTTTTCCCATTACATCCAATGACCATTACGAACGCAGAAAGGTTAAAGAAAGAGAGAGAAAAACAATCTCATGTTGAGGAACAGCCTACGACAGACTCTAAAGAAGAAGATTCCGTTGAAGCTGCCAACAATTT
Full Trace Sequence: CGGGGGCCATATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTTCATTTAACATCTCAGCTTTTGAAACGATATTATGGAGGACATGTTGCAATCCGACTGGCACTGGGTGGTTGTGCCAATAGGCCTTTCTATCGTGTTGTCGCTGCTCATAACAAGCGAGCAAGGGACGGAAAATTCTTAGAACAACTTGGCACATATGATCCAATGCCCAACATCTACAACGAAAAACTCGTCAGCCTAAATATTGAGAAAATCAAATACTGGATTGGCTGCGGAGCACATACTACAAAACCAGTTGCAAAGTTACTAGGCCTTGCAGGATTTTTCCCATTACATCCAATGACCATTACGAACGCAGAAAGGTTAAAGAAAGAGAGAGAAAAACAATCTCATGTTGAGGAACAGCCTACGACAGACTCTAAAGAAGAAGATTCCGTTGAAGCTGCCAACAATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGGCTGAAAAACTGAAAGATAATAACAAATGTCTCAAATCTCCCTTAAATTAACACGGCAGGGAAAGGATAAAATTTACAGGCTCCCCCCGGGAAACGGGGGGAAGTCCGCCTTGTTAAGTTTTGGGAGGGAAAAACCACACAAAAAAAAACAAAAACGGGCCGGGAACCCGAATATGAAGATACGAAAGGCCCCCCCAACGGGGGGGGCGAAAAACCTAATCCACCAAACCCCCCCGGTGGAATAACCCCCCCCGGGGGGGGTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTTCATTTAACATCTCAGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837482
dbEST ID: 79655184
Trimmed Sequence: ATTGTTGGCAGCTTCAACGGAATCTTCTTCTTTAGAGTCTGTCGTAGGCTGTTCCTCAACATGAGATTGTTTTTCTCTCTCTTTCTTTAACCTTTCTGCGTTCGTAATGGTCATTGGATGTAATGGGAAAAATCCTGCAAGGCCTAGTAACTTTGCAACTGGTTTTGTAGTATGTGCTCCGCAGCCAATCCAGTATTTGATTTTCTCAATATTTAGGCTGACGAGTTTTTCGTTGTAGATGTTGGGCATTGGATCATATGTGCCAAGTTGTTCTAAGAATTTTCCGTCCCTTGCTCGCTTGTTATGAGCAGCGACAACACGATAGAAAGGCCTATTGGCACAACCACCCAGTGCCAGTCGGATTGCAACATGTCCTCCATAATATCGTTTCAAAAGCTGAGATGTTAAATGAACCATGG
Full Trace Sequence: GGGTAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTGTTGGCAGCTTCAACGGAATCTTCTTCTTTAGAGTCTGTCGTAGGCTGTTCCTCAACATGAGATTGTTTTTCTCTCTCTTTCTTTAACCTTTCTGCGTTCGTAATGGTCATTGGATGTAATGGGAAAAATCCTGCAAGGCCTAGTAACTTTGCAACTGGTTTTGTAGTATGTGCTCCGCAGCCAATCCAGTATTTGATTTTCTCAATATTTAGGCTGACGAGTTTTTCGTTGTAGATGTTGGGCATTGGATCATATGTGCCAAGTTGTTCTAAGAATTTTCCGTCCCTTGCTCGCTTGTTATGAGCAGCGACAACACGATAGAAAGGCCTATTGGCACAACCACCCAGTGCCAGTCGGATTGCAACATGTCCTCCATAATATCGTTTCAAAAGCTGAGATGTTAAATGAACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCATTTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAGGATCATTATAAAAAAAAAAAAAAATAAAAATAGAACATCTTTCTACACTATAACGGAACGGGGAGGGAGTGATCAAACTCACTGCACCCCCGGATGAGGGGGGCGGTCCGCTTGGGGGATGGGGTAGGGGGGGGAAACCCTACGGAAAAAAAACAAAACCGCTCGGTAGCGGTTTTAGAAGTTTGGGTTTGGCTCGCCCCGCAGGGGGTGGCAAAACCTTTGACAGAACCGAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGTTGGCAGCTTCAACGG