ORFeome > mrps17 ORF1 – XORFeome v1.0

mrps17 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mrps17
Gene ID: 5730055
Gene Page ID: 5729999
ORF Xenbase ID: 17284863

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054221
Original XGC clone length: 426

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ839277
dbEST ID: 79656979
Trimmed Sequence: ATGTCAGCCATACGAGCTGCAGTCCATGCCAAATGGATTGTAGGGAAAGTTATTGGAACAAAGATGAGAAAGACTGCAAAAGTCAGAGTGACTAGGCTGGTGCTAGATCCTTACTTATTAAAGTATTACAACAAGAGAAAGACCTACTTTGCACATGATGCACAACAGCAGTGCACCATCGGAGATATAGTGTTGTTAAAAGCACTGCCAGAGAGGAGATCAAAACATGTGAAACATGAACTATCTGAGATTGTATTCAAAGTGGGGAGAGTGGTAGATCCCCTAACTGGGAGTAGATGTGCTGGAAGTGTGTTCCTCGATAGTCTGACAGCCAATGAAGATGCAAATGTTGCAAATCTTAATGAACAGCTTCAGAGTCTGGATATTACAGCCACTGCAAGTGAAGACAAAGCAGTGGATTCTTT
Full Trace Sequence: GCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGCCATACGAGCTGCAGTCCATGCCAAATGGATTGTAGGGAAAGTTATTGGAACAAAGATGAGAAAGACTGCAAAAGTCAGAGTGACTAGGCTGGTGCTAGATCCTTACTTATTAAAGTATTACAACAAGAGAAAGACCTACTTTGCACATGATGCACAACAGCAGTGCACCATCGGAGATATAGTGTTGTTAAAAGCACTGCCAGAGAGGAGATCAAAACATGTGAAACATGAACTATCTGAGATTGTATTCAAAGTGGGGAGAGTGGTAGATCCCCTAACTGGGAGTAGATGTGCTGGAAGTGTGTTCCTCGATAGTCTGACAGCCAATGAAGATGCAAATGTTGCAAATCTTAATGAACAGCTTCAGAGTCTGGATATTACAGCCACTGCAAGTGAAGACAAAGCAGTGGATTCTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGAAAAAAAAAAAAAAGTCACAAAATCCCAAAATGTAAAAGTAAAAAACCGGGGGGAAAAAAGACCCAATTCCCTCTCTCCAAAAGGGGGCGGGTTAAAAAAAAAAAAAAAAGAGGGGGGAAAACTCAACAGAGAACAAACCCCCGGTGGGGGGCGGCGGGGGAGGAGGAGGAAGCCGCGCCCCCGCCGCCGGGGGCGGCCCCCCCACTCCGCGGCGCAGCCCGCGGGAGATAAAGCACCCGAGGTGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGCCATACGAGCTGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839276
dbEST ID: 79656978
Trimmed Sequence: AAAATCCACTGCTTTGTCTTCACTTGCAGTGGCTGTAATATCCAAACTCTGAAGCTGTTCATTAAAATTTGCAACATTTGCATCTTCATTGGCTGTCAAACTATCGAGGAACACACTTCCAGCACATCTACTCCCAGTTAGGGGATCTACCACTCTCCCCACTTTGAATACAATCTCAAATAGTTCATGTTTCACATGTTTTGATCTCCTCTCTGGCAGTGCTTTTAACAACACTATATCTCCAATGGTGCACTGCTGTTGTGCATCATGTGCAAAGTAGGTCTTTCTCTTGTTGTAATACTTTAATAAGTAAGGATCTAGCACCAGCCTAGTCACTCTGACTTTTGCAGTCTTTCTCATCTTTGTTCCAATAACTTTCCCTACAATCCATTTGGCATGGACTGCAGCTCGTAAGGCTGACATGTTG
Full Trace Sequence: CGAGGAAAANGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAATCCACTGCTTTGTCTTCACTTGCAGTGGCTGTAATATCCAAACTCTGAAGCTGTTCATTAAAATTTGCAACATTTGCATCTTCATTGGCTGTCAAACTATCGAGGAACACACTTCCAGCACATCTACTCCCAGTTAGGGGATCTACCACTCTCCCCACTTTGAATACAATCTCAAATAGTTCATGTTTCACATGTTTTGATCTCCTCTCTGGCAGTGCTTTTAACAACACTATATCTCCAATGGTGCACTGCTGTTGTGCATCATGTGCAAAGTAGGTCTTTCTCTTGTTGTAATACTTTAATAAGTAAGGATCTAGCACCAGCCTAGTCACTCTGACTTTTGCAGTCTTTCTCATCTTTGTTCCAATAACTTTCCCTACAATCCATTTGGCATGGACTGCAGCTCGTAAGGCTGACATGTTGCCAACTTTTTTGTACAAAGTGGGCATTATAAAAAAGCATTGGTCATCAATTTGTTGCAACCAACAGGTCACTATCAGTCAAAAATAAAATCTTATTTGGGGCCCGAAAATAAAAATGGGCGGTCGTTTTAAACGCCATTGACTGGGGTGTTGCCGTGCAACTCTGGCCCGGATTCTCAATTCATTGGTCTGTGAAATAACAAAAAAAAAGAAAAGAACCTCTACCACAAAAGACAACAGAGGCTGGGCGAATGAGGTTTGGGGAAGGNAAAAAACCCTATAGAANGTAANCCNATTTTATGTGGGAAAAAAGGTGTGAGTTTCTTTTCACATTGTCGNNTTTTTTGTCTCATTTANATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAATCCACTGCTTTGTCTTCA