ORFeome > mrps2 ORF1 – XORFeome v1.0

mrps2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mrps2
Gene ID: 866298
Gene Page ID: 493892
ORF Xenbase ID: 17284881

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC133758
Original XGC clone length: 843

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ838463
dbEST ID: 79656165
Trimmed Sequence: ATGGCGGCCTGTACATTCACTGCTCTGCTAAGGACAGCATTCCCACGGTTTGGCGCTGCCAGTCTCCAGTCCTCACTATGTGTCGGGCCGGTCTCATACCCAGAGGCACGTGGGAGATGTTACAGTTCAGCCCCTGCGGCACATCAGCTCCAGGAAACCAGCACCGCCGACTTTACCCAGAAGCTTCTTATGAATCCTTTAAAGCATCCGGACTTCTTCAATGTAAAGGAACTCTTCTCCCTCCGAGAATTATTTGACGCCCGTGTTCATCTGGGACACAAGAAGGGATGTCGCCATAGGCTCATGGAATCCTACCTATTTGGATGCCGATTGGAACAAGATATAATAGACTTGGATCAGACAATGAGTCACCTACAGTTGGCGCTAAACATCACCGCACACATTGCTTACCGGAAAGGTGTCATCTTGTTCGTGAGTCGCAACCGGCAGTTCACCCATCTGATTGAAAGCACAGCCAAAGACTGCGGGGAATATGCGCACACGCGCTACTGGCAAGGGGGGCTGCTCACTAACGCCCCGGTGCAATACGGGGGTCGGCGTCCGACTCCCCGACCTGATCATCTTCCTCAGCTCCCTCAACAACGTATTCGAGCAGCACTTGGCGATCCGTGACGCAGCCGAGATGAATATCCCGACCATGGGGGATA
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCCTGTACATTCACTGCTCTGCTAAGGACAGCATTCCCACGGTTTGGCGCTGCCAGTCTCCAGTCCTCACTATGTGTCGGGCCGGTCTCATACCCAGAGGCACGTGGGAGATGTTACAGTTCAGCCCCTGCGGCACATCAGCTCCAGGAAACCAGCACCGCCGACTTTACCCAGAAGCTTCTTATGAATCCTTTAAAGCATCCGGACTTCTTCAATGTAAAGGAACTCTTCTCCCTCCGAGAATTATTTGACGCCCGTGTTCATCTGGGACACAAGAAGGGATGTCGCCATAGGCTCATGGAATCCTACCTATTTGGATGCCGATTGGAACAAGATATAATAGACTTGGATCAGACAATGAGTCACCTACAGTTGGCGCTAAACATCACCGCACACATTGCTTACCGGAAAGGTGTCATCTTGTTCGTGAGTCGCAACCGGCAGTTCACCCATCTGATTGAAAGCACAGCCAAAGACTGCGGGGAATATGCGCACACGCGCTACTGGCAAGGGGGGCTGCTCACTAACGCCCCGGTGCAATACGGGGGTCGGCGTCCGACTCCCCGACCTGATCATCTTCCTCAGCTCCCTCAACAACGTATTCGAGCAGCACTTGGCGATCCGTGACGCAGCCGAGATGAATATCCCGACCATGGGGGATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCCTGTACATTCACT

Sequences - 3ʹ (reverse) EST

Accession: JZ838462
dbEST ID: 79656164
Trimmed Sequence: CGCCTCGGAGATTTTACTCTGCAGCCCCTGTAGCAGCTCCATCTGCTTGCGCTTGTCTTTGGCCCGGTTGATGGTCATTTTAAAGAGGCGACAATAGAGTTCCATGGCGGGCGGGGAGTCGTCGTTGCCAGGGATGGGGTAAGTGATTAAGCTGGGGTTACAGTTGGTATCTACTATCCCCATGGTCGGGATATTCATCTTGGCTGCGTCACGGATCGCCAAGTGCTGCTCGAATACGTTGTTGAGGGAGCTGAGGAAGATGATCAGGTCGGGGAGTCGGACGCCGACCCCGTATTGCACCGGGGCGTTAGTGAGCAGCCCCCCTTGCCAGTAGCGCGTGTGCGCATATTCCCCGCAATCTTTGGCTGTGCTTTCAATCAGATGGGTGAACTGCCGGTTGCGACTCACGAACAAAATGACACCTTTCCTGTAAGCAATGTGTGCGGTGATGGTTAGCGCCGACTGTGGGGGGAGCGTTGTCTGATCGGAGTCTATGATATTTTGGTCCGGTCGGGATCGAAATAGGCTATGAGTTCATTACCCCTAGGCCGACATCCCGTTTTGGTGTCAGAAAAAGAACGAGGGCGTGCGGAGATTTCTCCAAGAGGAAAGGGAGGTGCGTTTGATTGAAAGAAAGTCGGGGAGGGCGGTGGCGGA
Full Trace Sequence: GGCGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGCCTCGGAGATTTTACTCTGCAGCCCCTGTAGCAGCTCCATCTGCTTGCGCTTGTCTTTGGCCCGGTTGATGGTCATTTTAAAGAGGCGACAATAGAGTTCCATGGCGGGCGGGGAGTCGTCGTTGCCAGGGATGGGGTAAGTGATTAAGCTGGGGTTACAGTTGGTATCTACTATCCCCATGGTCGGGATATTCATCTTGGCTGCGTCACGGATCGCCAAGTGCTGCTCGAATACGTTGTTGAGGGAGCTGAGGAAGATGATCAGGTCGGGGAGTCGGACGCCGACCCCGTATTGCACCGGGGCGTTAGTGAGCAGCCCCCCTTGCCAGTAGCGCGTGTGCGCATATTCCCCGCAATCTTTGGCTGTGCTTTCAATCAGATGGGTGAACTGCCGGTTGCGACTCACGAACAAAATGACACCTTTCCTGTAAGCAATGTGTGCGGTGATGGTTAGCGCCGACTGTGGGGGGAGCGTTGTCTGATCGGAGTCTATGATATTTTGGTCCGGTCGGGATCGAAATAGGCTATGAGTTCATTACCCCTAGGCCGACATCCCGTTTTGGTGTCAGAAAAAGAACGAGGGCGTGCGGAGATTTCTCCAAGAGGAAAGGGAGGTGCGTTTGATTGAAAGAAAGTCGGGGAGGGCGGTGGCGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGCCTCGGAGATTTTACTCTG