ORFeome > mrps25 ORF1 – XORFeome v1.0

mrps25 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mrps25
Gene ID: 961637
Gene Page ID: 961633
ORF Xenbase ID: 17284899

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141732
Original XGC clone length: 522

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ838890
dbEST ID: 79656592
Trimmed Sequence: ATGCCGATGAAAGGCAGGTTCCCGATTCGCAGGACTTTACAGTATCTACAGGCCGGGGAGATCGTGTTCAAGAACAACGTGAAAATAATGACGGTCAATTATAACACCCACGGGGAGCACGGAGAGGGGGCGAGGAAGTTTGTGTTTTTCAATATCCCTCAGATCCAATACCAGAATCCTTGGGTCCAGATAATGATGTTCAAGAATATGACTCCATCCCCTTTCCTAAGGTTTTATTTAGATAGTGGAGAGCAGGTTCTGGTTGACATCGATGACAAAAGCAACACAGAAATTTCACAGCATGTGAAGAAAATCTTGGGGAAGAAAGAGGAGACACTGAAGGCCGAAGAACAAGCGAAAATGGTGAAGTCCAATCCGGCCAACTTTGGTCTAAGGAAGTACCACCTGCGAGAGTGTATATGTGAAGTAGAGGGACAGGTGCCGTGCCCTTCAAAAATCCCACTGCCAAAGGAAATGACTGGCAAATACAAAGCTCAACAGAAGGAGAGGACTGAGGAGTT
Full Trace Sequence: GGGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGATGAAAGGCAGGTTCCCGATTCGCAGGACTTTACAGTATCTACAGGCCGGGGAGATCGTGTTCAAGAACAACGTGAAAATAATGACGGTCAATTATAACACCCACGGGGAGCACGGAGAGGGGGCGAGGAAGTTTGTGTTTTTCAATATCCCTCAGATCCAATACCAGAATCCTTGGGTCCAGATAATGATGTTCAAGAATATGACTCCATCCCCTTTCCTAAGGTTTTATTTAGATAGTGGAGAGCAGGTTCTGGTTGACATCGATGACAAAAGCAACACAGAAATTTCACAGCATGTGAAGAAAATCTTGGGGAAGAAAGAGGAGACACTGAAGGCCGAAGAACAAGCGAAAATGGTGAAGTCCAATCCGGCCAACTTTGGTCTAAGGAAGTACCACCTGCGAGAGTGTATATGTGAAGTAGAGGGACAGGTGCCGTGCCCTTCAAAAATCCCACTGCCAAAGGAAATGACTGGCAAATACAAAGCTCAACAGAAGGAGAGGACTGAGGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTTGCACGAACAGGTCACTATCAATCAAATTAAATCATTATTTGCCATCCAGCTGAATATCCTCAATATGAGTCCTAATTACTGAAAAAAACAAAATAAAGGAAAACTCTGGCCCCCGTCTCAAACATACGCAAATAAAAAAACAAATAAAAGCGCCCGGGGAGGCGGGGGCCTCCCTTTTTGGAGGTGGTAGGGGAGAAACCCCTGCCAAAAAACGCTTCTGCCCGCGAGGCGGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGATGAAAGGCAGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838889
dbEST ID: 79656591
Trimmed Sequence: CTCCTCAGTCCTCTCCTTCTGTTGAGCTTTGTATTTGCCAGTCATTTCCTTTGGCAGTGGGATTTTTGAAGGGCACGGCACCTGTCCCTCTACTTCACATATACACTCTCGCAGGTGGTACTTCCTTAGACCAAAGTTGGCCGGATTGGACTTCACCATTTTCGCTTGTTCTTCGGCCTTCAGTGTCTCCTCTTTCTTCCCCAAGATTTTCTTCACATGCTGTGAAATTTCTGTGTTGCTTTTGTCATCGATGTCAACCAGAACCTGCTCTCCACTATCTAAATAAAACCTTAGGAAAGGGGATGGAGTCATATTCTTGAACATCATTATCTGGACCCAAGGATTCTGGTATTGGATCTGAGGGATATTGAAAAACACAAACTTCCTCGCCCCCTCTCCGTGCTCCCCGTGGGTGTTATAATTGACCGTCATTATTTTCACGTTGTTCTTGAACACGATCTCCCCGGCCTGTAGATACTGTAAAGTCCTGCGAATCGGGAACCTGCCTTTCACCGGCATGG
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCCTCAGTCCTCTCCTTCTGTTGAGCTTTGTATTTGCCAGTCATTTCCTTTGGCAGTGGGATTTTTGAAGGGCACGGCACCTGTCCCTCTACTTCACATATACACTCTCGCAGGTGGTACTTCCTTAGACCAAAGTTGGCCGGATTGGACTTCACCATTTTCGCTTGTTCTTCGGCCTTCAGTGTCTCCTCTTTCTTCCCCAAGATTTTCTTCACATGCTGTGAAATTTCTGTGTTGCTTTTGTCATCGATGTCAACCAGAACCTGCTCTCCACTATCTAAATAAAACCTTAGGAAAGGGGATGGAGTCATATTCTTGAACATCATTATCTGGACCCAAGGATTCTGGTATTGGATCTGAGGGATATTGAAAAACACAAACTTCCTCGCCCCCTCTCCGTGCTCCCCGTGGGTGTTATAATTGACCGTCATTATTTTCACGTTGTTCTTGAACACGATCTCCCCGGCCTGTAGATACTGTAAAGTCCTGCGAATCGGGAACCTGCCTTTCACCGGCATGGTGCCAACTTTTTTGTACAAAGTTTGCATTATAAAAAAACATTGCTCATCAATTTTGTTGCACGAAAAGGGTCATATCAGTCCAAATAAAAAAATAAATAAAAGCCAGAGCTTAAAACTGGACATCGTTTAACAGAGGCCTTAACTGGGGTAGGGGGCGCCCAAGATAACGGGGCCCCATTTTTGGGATGGTTGTGAGGGAAAACCCTTGGAAAAAAAAAACATCTCGGCGGGGAAGGAGGATTAGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCTCAGTCCTCTCCTT