ORFeome > mrps36 ORF1 – XORFeome v1.0

mrps36 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mrps36
Gene ID: 6488649
Gene Page ID: 5729392
ORF Xenbase ID: 17284917

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128949
Original XGC clone length: 333

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ838982
dbEST ID: 79656684
Trimmed Sequence: ATGGGTAGCAAGATGGCGGCGGCCAGCAGGGTCGTTCAGGTTGTGAAGCCACATGTACCAACCAATTAGATTTCCTGATCGAAAGAACAGTCCTAAGCCTAGTGTACAAGAAGCTTTAAAGTCCATGATCTACCCCTTCAGTGCTCCCTCAGTAATACCACATCAAGGTGCAACTGGTAACCCTTCGTCAGGTACTCAGAATACTCCATCTGTACACAGAGTACCAAGTAAACCCGACACATTGGCTGTAATAAAACCACTGCCTCAGAAATACAGAAGAAAGATATTGAGCAATGAAGAAATGGAATATATCCAACGTGGAGGTCCTGAATT
Full Trace Sequence: TCGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTAGCAAGATGGCGGCGGCCAGCAGGGTCGTTCAGGTTGTGAAGCCACATGTACCAACCAATTAGATTTCCTGATCGAAAGAACAGTCCTAAGCCTAGTGTACAAGAAGCTTTAAAGTCCATGATCTACCCCTTCAGTGCTCCCTCAGTAATACCACATCAAGGTGCAACTGGTAACCCTTCGTCAGGTACTCAGAATACTCCATCTGTACACAGAGTACCAAGTAAACCCGACACATTGGCTGTAATAAAACCACTGCCTCAGAAATACAGAAGAAAGATATTGAGCAATGAAGAAATGGAATATATCCAACGTGGAGGTCCTGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGAAAAAAAAAAAAAAAAAAAAAAAAAAACATTATATTACTCCCCCTGGGGAGAGAGAAAAAAAAAAAAAAAAAAAACAATCTCTCCCCCGGGGGGGGGGGGGTGAAACTTTTAGGAAAAGAAAGAGGCAACCCCCCCTCGGAAAAAACCCTTTGCGGGGGGAGATTTAAAAAAAAGAAAAAACCCCCCCACCACCCACCCCAAAATGACAAACCCCGCGGGGGGGGGGGGGGAGGAGGTTTATTTTGTTTTAAATTTATTTTCTCCTCCTTCACAAGAGAGGGGGAACACAAAAAAACCCCAAAAACAACAAAGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTAGCAAGATGGCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838981
dbEST ID: 79656683
Trimmed Sequence: TTCAGGACCTCCACGTTGGATATATTCCATTTCTTCATTGCTCAATATCTTTCTTCTGTATTTCTGAGGCAGTGGTTTTATTACAGCCAATGTGTCGGGTTTACTTGGTACTCTGTGTACAGATGGAGTATTCTGAGTACCTGACGAAGGGTTACCAGTTGCACCTTGATGTGGTATTACTGAGGGAGCACTGAAGGGGTAGATCATGGACTTTAAAGCTTCTTGTACACTAGGCTTAGGACTGTTCTTTCGATCAGGAAATCTAATCGCTGGTACATGTGGCTTCACAACCTGAACGACCCTGCTGGCCGCCGCCATCTTGCTACCCATGG
Full Trace Sequence: GGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCAGGACCTCCACGTTGGATATATTCCATTTCTTCATTGCTCAATATCTTTCTTCTGTATTTCTGAGGCAGTGGTTTTATTACAGCCAATGTGTCGGGTTTACTTGGTACTCTGTGTACAGATGGAGTATTCTGAGTACCTGACGAAGGGTTACCAGTTGCACCTTGATGTGGTATTACTGAGGGAGCACTGAAGGGGTAGATCATGGACTTTAAAGCTTCTTGTACACTAGGCTTAGGACTGTTCTTTCGATCAGGAAATCTAATCGCTGGTACATGTGGCTTCACAACCTGAACGACCCTGCTGGCCGCCGCCATCTTGCTACCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGCCCGACCTTAATACTGAAAAAAAAAAAAACAACAAATTAGACTGGGATATTAACCAGAAAGAGAGAGCCAAGAAAAAAAAAAAACAAAACATGCCTCCGAGCAGAGGGGGGGTGTGTCACATGTGTGGGGGGGGAAAAGAAAACCACACACCGGGGACAAAACAACATGCGCGTGTGTTTTTTAATATAAGATGAAGTGGAGCGGCGCGCGCAACTCCTTGTCAAAAAAAAAACCAACCCCGGGGCGGGGGGAGGGGTGGTGNGTTGTTNNGGTTGNAGANNNCNGCCCNNNNGNGGGNGGGNNNNNNNNNAGNNNNNNNNNNNNNNNNGNNNNNNGNNAGNNNGNNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCAGGACCTCCACGTTGGAT