ORFeome > msantd3 ORF1 – XORFeome v1.0

msantd3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: msantd3
Gene ID: 5737853
Gene Page ID: 5737819
ORF Xenbase ID: 17284935

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043625
Original XGC clone length: 1098

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11012
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ823975
dbEST ID: 79641677
Trimmed Sequence: ATGCAAAACAACGAAGTGCTAAAGCCTGCCAAGTACTTCTCGGAGCTGGAAAAGAGTGTGTTACTGGCACTGGTGGAAAAGTATAAGTATGTCCTAGAATGCAAGAAAAGTGATGCTCGAACTATTGCCCTAAAGCAGCGCACATGGCAGGCTTTAGCCCATGAATATAACTCCCAGCCTAGTGTGTCACTAAGGGATTTTAAGCAGCTGAAGAAATGTTGGGAAAACATCAAAGCTAGGACCAAAAAGATCATGGCCCATGAAAGGAGAGAAAAGGGAAAACTTTTTGGCCCAGAGTCTAATAGTCATCAAGCATTGAAAGAAAAGGTTGCAAGTATGCTTCCTGAGCAACTCTATTTTGTACAAAACCAGCCAGAGGAAGAAAGAGGATACAACCATGATACTTCCAACCAAGAAATGGACTGCAAGAGAGTTAATTTGTTGGATCTGGAAGTACTTATTGATGAACAAGGCAAAATTCAGACCAAGCCTTTCAGGAAAGTGCCTGAAACAAATTTGTTATGTGATGATGGCTCACCTCCCCAGTCAATAGACAAAGCTTTTTCAAATGGAGATCTGGAACTTCTCATCGATGAGCAAGGTAAAATCCAAGCAGAACCAATTCNGGAAAGTGCCTGTCACAGATTCACAGTGCATACAGGGGCTCGCCTTCAAGCTCCCTNAGACAGAATCCTTTGTTGTTCCTGAAAGAAAAGTTGTATGAAGAATCAAAAATTTATTTACCAAAATGCCCCAATTCTTTAAAAAATCTGTTTTTTTTCAAAACCATAATTTTTCCCCCCCCCCCAAATATTA
Full Trace Sequence: CCAGTATCGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAAAACAACGAAGTGCTAAAGCCTGCCAAGTACTTCTCGGAGCTGGAAAAGAGTGTGTTACTGGCACTGGTGGAAAAGTATAAGTATGTCCTAGAATGCAAGAAAAGTGATGCTCGAACTATTGCCCTAAAGCAGCGCACATGGCAGGCTTTAGCCCATGAATATAACTCCCAGCCTAGTGTGTCACTAAGGGATTTTAAGCAGCTGAAGAAATGTTGGGAAAACATCAAAGCTAGGACCAAAAAGATCATGGCCCATGAAAGGAGAGAAAAGGGAAAACTTTTTGGCCCAGAGTCTAATAGTCATCAAGCATTGAAAGAAAAGGTTGCAAGTATGCTTCCTGAGCAACTCTATTTTGTACAAAACCAGCCAGAGGAAGAAAGAGGATACAACCATGATACTTCCAACCAAGAAATGGACTGCAAGAGAGTTAATTTGTTGGATCTGGAAGTACTTATTGATGAACAAGGCAAAATTCAGACCAAGCCTTTCAGGAAAGTGCCTGAAACAAATTTGTTATGTGATGATGGCTCACCTCCCCAGTCAATAGACAAAGCTTTTTCAAATGGAGATCTGGAACTTCTCATCGATGAGCAAGGTAAAATCCAAGCAGAACCAATTCNGGAAAGTGCCTGTCACAGATTCACAGTGCATACAGGGGCTCGCCTTCAAGCTCCCTNAGACAGAATCCTTTGTTGTTCCTGAAAGAAAAGTTGTATGAAGAATCAAAAATTTATTTACCAAAATGCCCCAATTCTTTAAAAAATCTGTTTTTTTTCAAAACCATAATTTTTCCCCCCCCCCCAAATATTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAAAACAACGAAGTGCTAAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829284
dbEST ID: 79646986
Trimmed Sequence: GGGTGAATTAGGAAAAGGCCTGTTAAATGATGCTACTGGCCACTCCTTGGTGATTGTCTGCAATTTTCTCTCCCAATACATTTTCTTTTTATTCAGGATCTCCATCTTTATCCGATGTTCCTCCTCAGCCATCTCACATTCTCTCTCAATCTGCTGTACTTTTGCCACATGCACCTCATTCATCTGAATCAACTGCAGCTGAAGGATAGACATCTGCTGGTGGTGTTGTTCTTCATGCATCTTTGTAAAAATGCCATTTTGTGATGGTTTGCGGCCATAGGTCCTATTAGCAGATAATTTGGAGGATGGGAATATAGGTGTTGAATGAACAGAGCTTTCAGAACTGTGCATGTTGGCTATAGAATTTTGATCTTCATACACATCTCTTTCAGGAACAACAAAGGATTCTGTCTTTAGGGAGCTTGAAGGCGAGCCCTGTATGCACTGTGAATCTGTGACAGGCACTTTCCGAATTGGTTCTGCTTGGATTTTACCTTGCTCATCGATGAGAAGTTCCAGATCTCCATTTGAAAAAGCTTTGTCTATTGACTGGGGAGGTGAGCCATCATCACATAACAAATTTGTTTCAGGCACTTTCCTGAAAAGCTTGGTCTGAATTTTGCCTTGTTCATCAATAAGTACTTCCAGAATCCACAAATTAACTCTTCTGCAATCCATTTTCTGGGTTGGAAGTATCAGGGTTGGTATCCTCCTTTCCTCCCCCTGGGCTGGTTTTGGTACCAAAAAAAAAGTTGCCTCAAGGAAACCAA
Full Trace Sequence: TGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGGTGAATTAGGAAAAGGCCTGTTAAATGATGCTACTGGCCACTCCTTGGTGATTGTCTGCAATTTTCTCTCCCAATACATTTTCTTTTTATTCAGGATCTCCATCTTTATCCGATGTTCCTCCTCAGCCATCTCACATTCTCTCTCAATCTGCTGTACTTTTGCCACATGCACCTCATTCATCTGAATCAACTGCAGCTGAAGGATAGACATCTGCTGGTGGTGTTGTTCTTCATGCATCTTTGTAAAAATGCCATTTTGTGATGGTTTGCGGCCATAGGTCCTATTAGCAGATAATTTGGAGGATGGGAATATAGGTGTTGAATGAACAGAGCTTTCAGAACTGTGCATGTTGGCTATAGAATTTTGATCTTCATACACATCTCTTTCAGGAACAACAAAGGATTCTGTCTTTAGGGAGCTTGAAGGCGAGCCCTGTATGCACTGTGAATCTGTGACAGGCACTTTCCGAATTGGTTCTGCTTGGATTTTACCTTGCTCATCGATGAGAAGTTCCAGATCTCCATTTGAAAAAGCTTTGTCTATTGACTGGGGAGGTGAGCCATCATCACATAACAAATTTGTTTCAGGCACTTTCCTGAAAAGCTTGGTCTGAATTTTGCCTTGTTCATCAATAAGTACTTCCAGAATCCACAAATTAACTCTTCTGCAATCCATTTTCTGGGTTGGAAGTATCAGGGTTGGTATCCTCCTTTCCTCCCCCTGGGCTGGTTTTGGTACCAAAAAAAAAGTTGCCTCAAGGAAACCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGTGAATTAGGAAAAGGC