ORFeome > msra.1 ORF1 – XORFeome v1.0

msra.1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: msra.1
Gene ID: 1011251
Gene Page ID: 1011249
ORF Xenbase ID: 17284959

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC053804
Original XGC clone length: 636

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ839519
dbEST ID: 79657221
Trimmed Sequence: ATGAGCTCGAAAACCCAACTCCCCAGCAAAGAAGGCTCCCTTCCGGGCAGATCTGAGAAGATGAGGGTCTCTGCTAAACATCATGTCAGTGGCAAGTCCATGGTCGAACCTTTCCCAGAGGGAACACAAATGGCAATATTCGGTATGGGCTGCTTTTGGGGAGCAGAAAGAAAGTTCTGGAGACAAAAAGGGGTCTACTCCACCCAAGTTGGCTATTCTGGAGGTTACACACCCAACCCGCTGTATGAAGAAGTCTGCTCAGGACGGACGGGACATGCAGAAGTGGTTCGAGTTGTCTACGAGCCAGAAAGCATCAACTTTGAGAAATTGATCAAGGTCTTCTGGGAGAATCATGACCCGACACAAGGAATGCGCCAGGGTAACGATGTTGGCACCATGTACCGCTCTGCAATCTACACCTACACTAAGGAGCAAACAGAGGCAGCTTTAAAGTCCAGAGAAGATTACCAAAAGGAGCTGAGTGCCCACGGCTATGGACAAATCACCACGGANATCAGTGAAGCAAAGAACTTCTACTACGCTGAGGATTATCACCAGCAGTACCTCAGCAAGATCCCAAACGGCTACTGCGGAATGGGGGGCACTGGAGTTACCTGCCCTATCGGCCTCAAATG
Full Trace Sequence: CGAGGCACCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCTCGAAAACCCAACTCCCCAGCAAAGAAGGCTCCCTTCCGGGCAGATCTGAGAAGATGAGGGTCTCTGCTAAACATCATGTCAGTGGCAAGTCCATGGTCGAACCTTTCCCAGAGGGAACACAAATGGCAATATTCGGTATGGGCTGCTTTTGGGGAGCAGAAAGAAAGTTCTGGAGACAAAAAGGGGTCTACTCCACCCAAGTTGGCTATTCTGGAGGTTACACACCCAACCCGCTGTATGAAGAAGTCTGCTCAGGACGGACGGGACATGCAGAAGTGGTTCGAGTTGTCTACGAGCCAGAAAGCATCAACTTTGAGAAATTGATCAAGGTCTTCTGGGAGAATCATGACCCGACACAAGGAATGCGCCAGGGTAACGATGTTGGCACCATGTACCGCTCTGCAATCTACACCTACACTAAGGAGCAAACAGAGGCAGCTTTAAAGTCCAGAGAAGATTACCAAAAGGAGCTGAGTGCCCACGGCTATGGACAAATCACCACGGANATCAGTGAAGCAAAGAACTTCTACTACGCTGAGGATTATCACCAGCAGTACCTCAGCAAGATCCCAAACGGCTACTGCGGAATGGGGGGCACTGGAGTTACCTGCCCTATCGGCCTCAAATGCCCACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGGCTAATCATTTGTGTCCACGAACAGGTCACTATCAGTCAAAAATAATCATTTTTTTGCCAATCACAACTAAAATAACCTAAAAGAAAATCAAAAAAAAAATGGTCAAAAACTTATTTCCCTGGAACCCTCGGCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCTCGAAAACCCAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839518
dbEST ID: 79657220
Trimmed Sequence: TTTGAGGCCGATAGGGCAGGTAACTCCAGTGCCCCCCATTCCGCAGTAGCCGTTTGGGATCTTGCTGAGGTACTGCTGGTGATAATCCTCAGCGTAGTAGAAGTTCTTTGCTTCACTGATTTCCGTGGTGATTTGTCCATAGCCGTGGGCACTCAGCTCCTTTTGGTAATCTTCTCTGGACTTTAAAGCTGCCTCTGTTTGCTCCTTAGTGTAGGTGTAGATTGCAGAGCGGTACATGGTGCCAACATCGTTACCCTGGCGCATTCCTTGTGTCGGGTCATGATTCTCCCAGAAGACCTTGATCAATTTCTCAAAGTTGATGCTTTCTGGCTCGTAGACAACTCGAACCACTTCTGCATGTCCCGTCCGTCCTGAGCAGACTTCTTCATACAGCGGGTTGGGTGTGTAACCTCCAGAATAGCCAACTTGGGTGGAGTAGACCCCTTTTTGTCTCCCGAACTTTCTTTCTGCTCCCCAAAAGCAGCCCATACCAAATATTGCCATTTGTGTTCCCTCTGGGGAAGGTTCGACCATGAACTTGCCACTGACATTGATGTTTAACAAAAACCCCCCTCCTTCTCGAATCGGCCCCGGAAGGGAGCCCTCTTTGCCGGGCAAGTTGGATTTTCCAAGCTAATGGTGGCCAATTTTTTTTTTAAAAATTTTAGAAAAAAAAAAAGGCCTTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Full Trace Sequence: GGGAATATGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGAGGCCGATAGGGCAGGTAACTCCAGTGCCCCCCATTCCGCAGTAGCCGTTTGGGATCTTGCTGAGGTACTGCTGGTGATAATCCTCAGCGTAGTAGAAGTTCTTTGCTTCACTGATTTCCGTGGTGATTTGTCCATAGCCGTGGGCACTCAGCTCCTTTTGGTAATCTTCTCTGGACTTTAAAGCTGCCTCTGTTTGCTCCTTAGTGTAGGTGTAGATTGCAGAGCGGTACATGGTGCCAACATCGTTACCCTGGCGCATTCCTTGTGTCGGGTCATGATTCTCCCAGAAGACCTTGATCAATTTCTCAAAGTTGATGCTTTCTGGCTCGTAGACAACTCGAACCACTTCTGCATGTCCCGTCCGTCCTGAGCAGACTTCTTCATACAGCGGGTTGGGTGTGTAACCTCCAGAATAGCCAACTTGGGTGGAGTAGACCCCTTTTTGTCTCCCGAACTTTCTTTCTGCTCCCCAAAAGCAGCCCATACCAAATATTGCCATTTGTGTTCCCTCTGGGGAAGGTTCGACCATGAACTTGCCACTGACATTGATGTTTAACAAAAACCCCCCTCCTTCTCGAATCGGCCCCGGAAGGGAGCCCTCTTTGCCGGGCAAGTTGGATTTTCCAAGCTAATGGTGGCCAATTTTTTTTTTAAAAATTTTAGAAAAAAAAAAAGGCCTTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGAGGCCGATAGGGCAGGT