ORFeome > mtch2 ORF1 – XORFeome v1.0

mtch2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mtch2
Gene ID: 997520
Gene Page ID: 997513
ORF Xenbase ID: 17285001

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054302
Original XGC clone length: 894

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ839497
dbEST ID: 79657199
Trimmed Sequence: ATGGCGGATACAAGCAGTCAGCTAATGTTGGGCGCCGGCCTGACAGTTTTGTCGCACCCGATGATGTATGTAAAGGTGCTGGTGCAGGTGGGACATGAGCCACTACCACCAACATTGGGAAGAAACCTTTTTGGACGTCAGGTCTACCAACTCCCAGGTCTTTTCTCCTATGCCAAACACATCATTAGTATCGATGGGAAGAGCGGCCTCTTCAAGGGCTTGGTTCCCAGACTCTGTGCAGGAGCCATTGGGACTGTGGTGCACAGTAATGTCTTGCAGCGCTATCAGGATCCCGATGCTACTGAAGAAAATGAACAGAAAGATAGCTCAACCTCACTGGATCTCATTGTCAAAGAGACAACTCAGGAGATGGTTGCCCGTTCTGCAGCTGCCCTTGTTACACATCCCTTACATGTGATCACGCTACGCTGTATGGTGCAGTTTATAGGAAGAGAGACCAAATATAGTGGGCTCTTTGGATCCATTGCGACGATATACAGAGAGGAAGGCATTCTTGGCTTTTTTGCGGGATTTATACCAAGGCTTTTAGGGGACATATTTTCCCTATGGATCTGCAACATGGCAGCTTATCTCATAAACAAGTACGCTCTGGAAAATGGGGCAGGCGGAGAGATGAAAAGTTATTCTCGGGCATTTACTGGGGTTCCTGGCCAGTATTCTGACGTACCCCCTTGTCCTGGTTTCCANTATCATGGCTGTGAAATAACTGTGGGGTTGGCCGGGGGGGCTGCCTCATTATGCTGCTG
Full Trace Sequence: GCCCCCAAATAATAGATTTTATTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGATACAAGCAGTCAGCTAATGTTGGGCGCCGGCCTGACAGTTTTGTCGCACCCGATGATGTATGTAAAGGTGCTGGTGCAGGTGGGACATGAGCCACTACCACCAACATTGGGAAGAAACCTTTTTGGACGTCAGGTCTACCAACTCCCAGGTCTTTTCTCCTATGCCAAACACATCATTAGTATCGATGGGAAGAGCGGCCTCTTCAAGGGCTTGGTTCCCAGACTCTGTGCAGGAGCCATTGGGACTGTGGTGCACAGTAATGTCTTGCAGCGCTATCAGGATCCCGATGCTACTGAAGAAAATGAACAGAAAGATAGCTCAACCTCACTGGATCTCATTGTCAAAGAGACAACTCAGGAGATGGTTGCCCGTTCTGCAGCTGCCCTTGTTACACATCCCTTACATGTGATCACGCTACGCTGTATGGTGCAGTTTATAGGAAGAGAGACCAAATATAGTGGGCTCTTTGGATCCATTGCGACGATATACAGAGAGGAAGGCATTCTTGGCTTTTTTGCGGGATTTATACCAAGGCTTTTAGGGGACATATTTTCCCTATGGATCTGCAACATGGCAGCTTATCTCATAAACAAGTACGCTCTGGAAAATGGGGCAGGCGGAGAGATGAAAAGTTATTCTCGGGCATTTACTGGGGTTCCTGGCCAGTATTCTGACGTACCCCCTTGTCCTGGTTTCCANTATCATGGCTGTGAAATAACTGTGGGGTTGGCCGGGGGGGCTGCCTCATTATGCTGCTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGATACAAGCAGTCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839496
dbEST ID: 79657198
Trimmed Sequence: ATAAAATCTCTTGTGTTCTAGCACGTATCTCTTCCCTTCAGGCACCTTGCGGAAGAACAGGCTGTTGCCCCGATTTGTGTTCCCCTCTTTGCTGAGTTGTGTCCAGCAGTCTGTCCAAGAGGTATATGCAGCAGCATAAGGAGGCAGCCCCCCGGCCAACCCACAGTTATTCACAGCCATGATATTGGAAACCAGGACAAAGGGGTACGTCAGAATACTGGCCAGGAACCCAGTAAATGCCCGAGAATAACTTTTCATCTCTCCGCCTGCCCCATTTTCCAGAGCGTACTTGTTTATGAGATAAGCTGCCATGTTGCAGATCCATAGGGAAAATATGTCCCCTAAAAGCCTTGGTATAAATCCCGCAAAAAAGCCAAGAATGCCTTCCTCTCTGTATATCGTCGCAATGGATCCAAAGAGCCCACTATATTTGGTCTCTCTTCCTATTAACTGCACCATACAGCGTAGCGTGATCACATGTAAAGGGATGTGTAACAAGGGCAGCTGCAGAACGGGCAACCATCTCCTGAGTTGTCTCTTTGACAATGAAATCCAGTGAAGTTTAACTATCTTTCTGTTCCATTCCTTTAGTAGCAATCGGATCCCGAAAATCCCTGCAGGAACTTTACGGTTGCACCACAATCCCAATAGCCTCCTGGGCCGAGGGCGGGG
Full Trace Sequence: GGGAAACATGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAAAATCTCTTGTGTTCTAGCACGTATCTCTTCCCTTCAGGCACCTTGCGGAAGAACAGGCTGTTGCCCCGATTTGTGTTCCCCTCTTTGCTGAGTTGTGTCCAGCAGTCTGTCCAAGAGGTATATGCAGCAGCATAAGGAGGCAGCCCCCCGGCCAACCCACAGTTATTCACAGCCATGATATTGGAAACCAGGACAAAGGGGTACGTCAGAATACTGGCCAGGAACCCAGTAAATGCCCGAGAATAACTTTTCATCTCTCCGCCTGCCCCATTTTCCAGAGCGTACTTGTTTATGAGATAAGCTGCCATGTTGCAGATCCATAGGGAAAATATGTCCCCTAAAAGCCTTGGTATAAATCCCGCAAAAAAGCCAAGAATGCCTTCCTCTCTGTATATCGTCGCAATGGATCCAAAGAGCCCACTATATTTGGTCTCTCTTCCTATTAACTGCACCATACAGCGTAGCGTGATCACATGTAAAGGGATGTGTAACAAGGGCAGCTGCAGAACGGGCAACCATCTCCTGAGTTGTCTCTTTGACAATGAAATCCAGTGAAGTTTAACTATCTTTCTGTTCCATTCCTTTAGTAGCAATCGGATCCCGAAAATCCCTGCAGGAACTTTACGGTTGCACCACAATCCCAATAGCCTCCTGGGCCGAGGGCGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAAAATCTCTTGTGTTCTAGCAC