ORFeome > mtfp1 ORF1 – XORFeome v1.0

mtfp1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mtfp1
Gene ID: 6252931
Gene Page ID: 1001677
ORF Xenbase ID: 17285019

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124889
Original XGC clone length: 495

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ838847
dbEST ID: 79656549
Trimmed Sequence: ATGGGGCACCAGCAGCAGCAGCCGGGCAAGTCCTCAGAGAAAGACTTGTACAGGGACACATGGGTGCGATATCTGGGTTATGCCAATGAGGTTGGGGAGGCGTTTCGAGCACTAGTTCCCAAAGCAGTGGTTTGGGCCAGCTATGGAGTAGCCACGGCCTATGTCACGGCTGATGCAGCAGATAAGGGCAAGAAAGCAGCAAATTCTTATAAAGAAAGCCCAGACCAGACAGCACAAGTCGCGGTGGCTGTAGTGGACACTTTTGTATGGCAAGCTTTAGCATCAGTGGCTATTCCAGGCTTTACTATTAATCGGCTTTGTGCAGCGTCTCTCTATCTCATGGGACGAGTAACACGCTGGCCTCTCCCTGTTCGAAAGTGGGCAACCACCGCAGTAGGACTGTCTGCAATCCCCATTATTATAACACCAATCGACGGGTCAGTAGATTGGATGCTGGACTCCAGTCTTCGGAAACTGTACAGCAAATCCCATTT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGCACCAGCAGCAGCAGCCGGGCAAGTCCTCAGAGAAAGACTTGTACAGGGACACATGGGTGCGATATCTGGGTTATGCCAATGAGGTTGGGGAGGCGTTTCGAGCACTAGTTCCCAAAGCAGTGGTTTGGGCCAGCTATGGAGTAGCCACGGCCTATGTCACGGCTGATGCAGCAGATAAGGGCAAGAAAGCAGCAAATTCTTATAAAGAAAGCCCAGACCAGACAGCACAAGTCGCGGTGGCTGTAGTGGACACTTTTGTATGGCAAGCTTTAGCATCAGTGGCTATTCCAGGCTTTACTATTAATCGGCTTTGTGCAGCGTCTCTCTATCTCATGGGACGAGTAACACGCTGGCCTCTCCCTGTTCGAAAGTGGGCAACCACCGCAGTAGGACTGTCTGCAATCCCCATTATTATAACACCAATCGACGGGTCAGTAGATTGGATGCTGGACTCCAGTCTTCGGAAACTGTACAGCAAATCCCATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTTTTTGCACGAAACAGTTCACTATCGTCCAAATAAAATCATTATTTGCCATCAACTTAAATCCCCTATAGTGAGTCGTAATACATGTTCATAACTGTAAAAAAGAAAAAAAGAACCCTTTCTCATAATCTTCTATAGTTAAAGGAAAAAAAACACAAATTCTTCGCCGAAAAAGTGGTGTTGTTGTGTTCTGTGTTGTTTTAGAAGGAGAACGCATACACAAGAGGANACCCTGTGGCGGGGGTGTTGTATAAAAGATAAAAAAAAAAAAAAAAAAAAGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGCACCAGCAGCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838846
dbEST ID: 79656548
Trimmed Sequence: ATGGGATTTGCTGTACAGTTTCCGAAGACTGGAGTCCAGCATCCAATCTACTGACCCGTCGATTGGTGTTATAATAATGGGGATTGCAGACAGTCCTACTGCGGTGGTTGCCCACTTTCGAACAGGGAGAGGCCAGCGTGTTACTCGTCCCATGAGATAGAGAGACGCTGCACAAAGCCGATTAATAGTAAAGCCTGGAATAGCCACTGATGCTAAAGCTTGCCATACAAAAGTGTCCACTACAGCCACCGCGACTTGTGCTGTCTGGTCTGGGCTTTCTTTATAAGAATTTGCTGCTTTCTTGCCCTTATCTGCTGCATCAGCCGTGACATAGGCCGTGGCTACTCCATAGCTGGCCCAAACCACTGCTTTGGGAACTAGTGCTCGAAACGCCTCCCCCACCTCATTGGCATAACCCAGATATCGCACCCATGTGTCCCTGTACAAGTCTTTCTCTGACGACTTGCCCGGCTGCTGCTGCTGGTGCCCCATGG
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGGGATTTGCTGTACAGTTTCCGAAGACTGGAGTCCAGCATCCAATCTACTGACCCGTCGATTGGTGTTATAATAATGGGGATTGCAGACAGTCCTACTGCGGTGGTTGCCCACTTTCGAACAGGGAGAGGCCAGCGTGTTACTCGTCCCATGAGATAGAGAGACGCTGCACAAAGCCGATTAATAGTAAAGCCTGGAATAGCCACTGATGCTAAAGCTTGCCATACAAAAGTGTCCACTACAGCCACCGCGACTTGTGCTGTCTGGTCTGGGCTTTCTTTATAAGAATTTGCTGCTTTCTTGCCCTTATCTGCTGCATCAGCCGTGACATAGGCCGTGGCTACTCCATAGCTGGCCCAAACCACTGCTTTGGGAACTAGTGCTCGAAACGCCTCCCCCACCTCATTGGCATAACCCAGATATCGCACCCATGTGTCCCTGTACAAGTCTTTCTCTGACGACTTGCCCGGCTGCTGCTGCTGGTGCCCCATGGTGCCAACTTTTTTGTACAAGTTGGCATTATAAAAAACCATTGCTCATCAATTTGTTGCCCCGAACAGGTCACTATCCGTCCAAATAAAATCCATTTTTTAAAAAAAAAAAAAAAATACAAGAACTCATTTTCACCTCCTTTTAACAAACGGGGCGAAAAAAACCCCCATGCTCCTCTCCGCCCGGGGTGCCTTGTGGCTATTCTGTTGTTGTGGGGGGGGGGCCCCCACCCAGGAAGAAAAAACCCAGATTACACAAAAATAAAACTTTTGGAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGGGATTTGCTGTACAGTTTC