ORFeome > mtg2 ORF1 – XORFeome v1.0

mtg2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mtg2
Gene ID: 974620
Gene Page ID: 974613
ORF Xenbase ID: 17285043

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099033
Original XGC clone length: 1221

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ837118
dbEST ID: 79654820
Trimmed Sequence: ATGATGCTGGCTGCACAGTTTCTGTCTCGCCTTCGGGTGCTGGCGGAGGAGCTGAGGAGGTGCCAGACTGCTTTGGGCCAGCACACGCTTCTTCTTAACTCTACACTGGGCCCTGCAGCAGAACCAAAACGCTTGCTCTCCACTGGCTGCCATCAAAGGGCAAAGCACCGTAGCGTTGCTGGAAAGAAGCCTGAATTGTCCGAGAAGAAGTTGACAAGGTATTTTGTGGATCACCGCCGGGTCCGAGTGGTGGCAGGAGCTGGTGGGAATGGTGCCTGCTGCTTCCATAGCGAGCCCAGAAAGGAGTATGGGGGTCCAGATGGAGGAGATGGAGGAAATGGGGGGCACATCATACTGAAAGCTGATCCCAGGGTGAAGTCTCTTTCCACTGTCACACCTTTGTATAAAGGGAGTAACGGGGAACGTGGGCGCAGCGATAACTGCTTTGGAAGAAATGGGGACAGCATTTATATCAGGGTTCCACTGGGCACACTGGTGAAAGAGGAAGGGAAGCTCCTTGCCGACCTCTCAAAGCCAGGAGGATGAGTTTTTGGCAGCTCATGGGGGGAGTTGGTGGAAAAGGGAAAAAAATTCTTCCTCATTCATGAAAACCGTGCACCAGTGATGGCTACACGAGGCCAGCCAGGAGAAGAAACGAATTCCTGCCTTTCTAGTTAAAGAGAAAAGAAATGCCTGGCTTGGGGGGGAGTGCGGGGGGCGGAAAAAAGAACCCAAAAGGGCCCTTTATAGGGGGGGGCAAACAAACTTGGGCGCGCCCCTCCCTTTTTCCCCCCCCCCACTCCCCACCCTTCGTGGGGG
Full Trace Sequence: GACACCATATAATAGATTTTANTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGCTGGCTGCACAGTTTCTGTCTCGCCTTCGGGTGCTGGCGGAGGAGCTGAGGAGGTGCCAGACTGCTTTGGGCCAGCACACGCTTCTTCTTAACTCTACACTGGGCCCTGCAGCAGAACCAAAACGCTTGCTCTCCACTGGCTGCCATCAAAGGGCAAAGCACCGTAGCGTTGCTGGAAAGAAGCCTGAATTGTCCGAGAAGAAGTTGACAAGGTATTTTGTGGATCACCGCCGGGTCCGAGTGGTGGCAGGAGCTGGTGGGAATGGTGCCTGCTGCTTCCATAGCGAGCCCAGAAAGGAGTATGGGGGTCCAGATGGAGGAGATGGAGGAAATGGGGGGCACATCATACTGAAAGCTGATCCCAGGGTGAAGTCTCTTTCCACTGTCACACCTTTGTATAAAGGGAGTAACGGGGAACGTGGGCGCAGCGATAACTGCTTTGGAAGAAATGGGGACAGCATTTATATCAGGGTTCCACTGGGCACACTGGTGAAAGAGGAAGGGAAGCTCCTTGCCGACCTCTCAAAGCCAGGAGGATGAGTTTTTGGCAGCTCATGGGGGGAGTTGGTGGAAAAGGGAAAAAAATTCTTCCTCATTCATGAAAACCGTGCACCAGTGATGGCTACACGAGGCCAGCCAGGAGAAGAAACGAATTCCTGCCTTTCTAGTTAAAGAGAAAAGAAATGCCTGGCTTGGGGGGGAGTGCGGGGGGCGGAAAAAAGAACCCAAAAGGGCCCTTTATAGGGGGGGGCAAACAAACTTGGGCGCGCCCCTCCCTTTTTCCCCCCCCCCACTCCCCACCCTTCGTGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGCTGGCTGCACAGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837117
dbEST ID: 79654819
Trimmed Sequence: CCAGGCTGCCAGTGCGTTACTGCTGTGCTGACTGTGTCCATCATATAATTCTCGCAGGTGCAGTATAAGCTCTTCTGCATTCTCTCCAGTAAGTGCAGAAACGCCAATCACTTTGCTGTCAGTCTCCTGTCGCAGACGCTGAAGGGTCTCTTGTGCCACTGGAAGGTCGAGCTTGTTTGCCACAATAACCTGAGGCCGCCCAAGCAAGTCCTTGTCGTATTGTTCCAGTTCATACCGCAGGGACTCCAGCTGGGCCCAGGGCTCCTTATGGGAAAGGTCCAGTACAAAGAGGAGAATGCGGCAACGTTCAATGTGTCGGAGGAAGGCGAAACCCAGTCCCCGGTTCTGATGGGCACCATCTATGATACCTGGAATATCAGCCACTGCTATTTGCACATAATCCCGGTATTTAATGACCCCCACGTGTGGATTTAGGGTGGTAAAAGGGTACGCTGCAACAGCTGGACGGGCATTTGATAAAAGGCGCAATAGTGACGACTTTCCTGCATTGGGAAATCCCACCATGCCAGCATGTGCCATCCTCTTTATCTCCAAGTGCAGAATTCGCTCCTCTCCCTGCTCGCCTGGTGTAGCCATCATTGTTGCACGGGTTTCTTTGCTTAAGAAAAAATCTATTTTCCTTTTTCACCAACTCCCCCCCTGAAGCTGCCAAAAAACTCATCCCCCTGGCTTTTGAAAGGTCGGGCAGGAAAAGTTCCCCTTTCCCCCTTTTTATCACTTTTTTCCCCCCCTTTGAAAAA
Full Trace Sequence: GGGCAAAAAGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCAGGCTGCCAGTGCGTTACTGCTGTGCTGACTGTGTCCATCATATAATTCTCGCAGGTGCAGTATAAGCTCTTCTGCATTCTCTCCAGTAAGTGCAGAAACGCCAATCACTTTGCTGTCAGTCTCCTGTCGCAGACGCTGAAGGGTCTCTTGTGCCACTGGAAGGTCGAGCTTGTTTGCCACAATAACCTGAGGCCGCCCAAGCAAGTCCTTGTCGTATTGTTCCAGTTCATACCGCAGGGACTCCAGCTGGGCCCAGGGCTCCTTATGGGAAAGGTCCAGTACAAAGAGGAGAATGCGGCAACGTTCAATGTGTCGGAGGAAGGCGAAACCCAGTCCCCGGTTCTGATGGGCACCATCTATGATACCTGGAATATCAGCCACTGCTATTTGCACATAATCCCGGTATTTAATGACCCCCACGTGTGGATTTAGGGTGGTAAAAGGGTACGCTGCAACAGCTGGACGGGCATTTGATAAAAGGCGCAATAGTGACGACTTTCCTGCATTGGGAAATCCCACCATGCCAGCATGTGCCATCCTCTTTATCTCCAAGTGCAGAATTCGCTCCTCTCCCTGCTCGCCTGGTGTAGCCATCATTGTTGCACGGGTTTCTTTGCTTAAGAAAAAATCTATTTTCCTTTTTCACCAACTCCCCCCCTGAAGCTGCCAAAAAACTCATCCCCCTGGCTTTTGAAAGGTCGGGCAGGAAAAGTTCCCCTTTCCCCCTTTTTATCACTTTTTTCCCCCCCTTTGAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCAGGCTGCCAGTGCGT