ORFeome > murc ORF1 – XORFeome v1.0

murc ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: murc
Gene ID: 877096
Gene Page ID: 877090
ORF Xenbase ID: 17285151

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129673
Original XGC clone length: 1080

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ838612
dbEST ID: 79656314
Trimmed Sequence: ATGGATCATGAAACAAGTTCAGAGAAAGACAGGGTCAACCTGAATCGTTTATCCATGGTCTCAGAGGATTCAGTAGATCACGATGCAGCCTTGACTATTGTCGCAGTTCTGGACAAAGTAGCCACGATTGTAGACACTGTGCAGGCAAGTCAAAAAAGGATTGAGGAGCGACACAGAGAAATGGAGGATGCGATCAAGACAATTCAAATTGAACTCTTGAAGCTTGCACAAGCTCACAGCAATACAAGTTACACAGTTAACAAATTGCTTGAAAAGACCCGCAAAGTCAGCTCCAATGTAAAAGATGTAAAGTCTCGAGTTGACAAGCAGAGTGATCAGGTCCAAAAGGTGGAGTCCAAACAAGAGGAGATGCTGAGAAAAAATAAATTCAGAGTTGTTATTTTTCAGGAGGATATTGAATGTCCAACAAAACTGACAGTTGCTAAGCAATCAGCATTAGATGGGAACCTAAGGGATGACTTATACCCACCAGATGACCTGTCTTCTGATGAGGAATATAGTGTGCAAGAAAGTCGGACTTCACGCCTAAGAAAATCTGGAATGAAGCGTATTAATAACATAAAGAAGGCATTTTCAAAAGAAAGCATGCAGAAAACAAAGCAAAACTTTTGGAAACAAGTTCAACAGGTTACGCACAAGGATTGTAACTCCCGAGAAAAGAGAAAGATTAAGGCAGTCCTGGTGAAAGGCTGGAAACCTTCGGGGAAAAAGGTTCAAAACAATCAAAAACCAAAAGGGAGCCCCCCCAAAAAAAAGGGC
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATCATGAAACAAGTTCAGAGAAAGACAGGGTCAACCTGAATCGTTTATCCATGGTCTCAGAGGATTCAGTAGATCACGATGCAGCCTTGACTATTGTCGCAGTTCTGGACAAAGTAGCCACGATTGTAGACACTGTGCAGGCAAGTCAAAAAAGGATTGAGGAGCGACACAGAGAAATGGAGGATGCGATCAAGACAATTCAAATTGAACTCTTGAAGCTTGCACAAGCTCACAGCAATACAAGTTACACAGTTAACAAATTGCTTGAAAAGACCCGCAAAGTCAGCTCCAATGTAAAAGATGTAAAGTCTCGAGTTGACAAGCAGAGTGATCAGGTCCAAAAGGTGGAGTCCAAACAAGAGGAGATGCTGAGAAAAAATAAATTCAGAGTTGTTATTTTTCAGGAGGATATTGAATGTCCAACAAAACTGACAGTTGCTAAGCAATCAGCATTAGATGGGAACCTAAGGGATGACTTATACCCACCAGATGACCTGTCTTCTGATGAGGAATATAGTGTGCAAGAAAGTCGGACTTCACGCCTAAGAAAATCTGGAATGAAGCGTATTAATAACATAAAGAAGGCATTTTCAAAAGAAAGCATGCAGAAAACAAAGCAAAACTTTTGGAAACAAGTTCAACAGGTTACGCACAAGGATTGTAACTCCCGAGAAAAGAGAAAGATTAAGGCAGTCCTGGTGAAAGGCTGGAAACCTTCGGGGAAAAAGGTTCAAAACAATCAAAAACCAAAAGGGAGCCCCCCCAAAAAAAAGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCATGAAACAAGTTCAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838611
dbEST ID: 79656313
Trimmed Sequence: CTGGGACAGATTTATGTCTACCAGTGGTATCTCATCTGACTCTGCTTTCTTTTCCACTTTCAACAAAGGCTTCTCTGTTTTTTCTGGAACGGGGCTAGGTTTCTCATCCTCTTGGGACAGCAGAAGTTCAGCATTTTCCTCATTCTTCTTCTTCTTCTTTTTTACAGTCACCACTTCTGTGTATGTGACCTCTTCAGAGATAGGTTTAGCAGTAGGCTCCTCAGAGTCTGTTTCATCTTCTTTACCACCTTCCTGTCCTTCTGCGGTGGTCCTCTGTTTTCCCTTCTTTTTAATGTTAATTTTAAAGGCCTCTTTTTTGGGTGCTGCCTTTGCTATTGATTGTTTGAACCTTTCTCCAGACGTTTTCAGCCTCTCACCAGACTGCCTTAATCTTTCTCTTCTCTCTGGAGTTACAATCCTTGTGCGTAACCTGTTGACTTTGTTTCCAAAGTTTTGCTTCGTTTTCTGCATGCTTTCTTTTGAAAATGCCTTCTTTATGTTATTAATACGCTTCATTCCAGATTTTTTTAGGCGTGAAGTCCGACTTTCTTGCACACTATATTCCTCATCAAAAGACAGGTCATCTGGGTGGGTATAAGTCATCCCCTTAGGTTTCCATTCTATGCTGATTGCTTAACCAACTGTCAGTTTTTTTGGGACATTCCATATTCTTCCTGAAAAATAACAACTCCTAATTTATTTTTTTCTCAGCCATCTCCCCTTGGTTGGACCTCCCCCTTTTTGGAACCCTAAATCCCTCTGCTTTTTCCACTTTAAA
Full Trace Sequence: GGGAAACTGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGGGACAGATTTATGTCTACCAGTGGTATCTCATCTGACTCTGCTTTCTTTTCCACTTTCAACAAAGGCTTCTCTGTTTTTTCTGGAACGGGGCTAGGTTTCTCATCCTCTTGGGACAGCAGAAGTTCAGCATTTTCCTCATTCTTCTTCTTCTTCTTTTTTACAGTCACCACTTCTGTGTATGTGACCTCTTCAGAGATAGGTTTAGCAGTAGGCTCCTCAGAGTCTGTTTCATCTTCTTTACCACCTTCCTGTCCTTCTGCGGTGGTCCTCTGTTTTCCCTTCTTTTTAATGTTAATTTTAAAGGCCTCTTTTTTGGGTGCTGCCTTTGCTATTGATTGTTTGAACCTTTCTCCAGACGTTTTCAGCCTCTCACCAGACTGCCTTAATCTTTCTCTTCTCTCTGGAGTTACAATCCTTGTGCGTAACCTGTTGACTTTGTTTCCAAAGTTTTGCTTCGTTTTCTGCATGCTTTCTTTTGAAAATGCCTTCTTTATGTTATTAATACGCTTCATTCCAGATTTTTTTAGGCGTGAAGTCCGACTTTCTTGCACACTATATTCCTCATCAAAAGACAGGTCATCTGGGTGGGTATAAGTCATCCCCTTAGGTTTCCATTCTATGCTGATTGCTTAACCAACTGTCAGTTTTTTTGGGACATTCCATATTCTTCCTGAAAAATAACAACTCCTAATTTATTTTTTTCTCAGCCATCTCCCCTTGGTTGGACCTCCCCCTTTTTGGAACCCTAAATCCCTCTGCTTTTTCCACTTTAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGGACAGATTTATGTCTAC