ORFeome > mustn1 ORF1 – XORFeome v1.0

mustn1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mustn1
Gene ID: 6078553
Gene Page ID: 1001563
ORF Xenbase ID: 17285157

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123175
Original XGC clone length: 243

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: F08

Sequences - 5ʹ (forward) EST

Accession: JZ838091
dbEST ID: 79655793
Trimmed Sequence: ATGTCCCAACCACAGGATGCCCCAGTTAAGAAGAAGAGGCCTCCGATGAAGGAAGAAGACCTTAAAGGAGCAAAAAACAAGCTGGCCCACCAAGTCCCAATCAAATCCAAAACATACCAGGTTATGAAGGAATGCGAACAATCTGGAACAATGGCCCCTTCTGTGTTCAGCCAGAACAAGACCGGCGGAGAAACAGCTTTTGATAAGCCGAAGGCCGGCCCGGCAAAAAGTGTCTTTGGTTT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCCAACCACAGGATGCCCCAGTTAAGAAGAAGAGGCCTCCGATGAAGGAAGAAGACCTTAAAGGAGCAAAAAACAAGCTGGCCCACCAAGTCCCAATCAAATCCAAAACATACCAGGTTATGAAGGAATGCGAACAATCTGGAACAATGGCCCCTTCTGTGTTCAGCCAGAACAAGACCGGCGGAGAAACAGCTTTTGATAAGCCGAAGGCCGGCCCGGCAAAAAGTGTCTTTGGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCAGAATCTAAAAATCTCAAAAAATACAAATGGCCCGCCTAATCGCCGCGGAAGAAGAGCAAAAAATAAAGGGTCTCCCCTGAAACCGGGGGGGCGGAGATTTTGTTGTTTTTTGAGGGGAACCCCCGGGTGGCCGGGGAAACCCCCGTCCGGGGAATTGTGAGGGGGGAAAAATCCGCCCGGGACCAGCCCCCCTCCCCGCCACAAACCCGGGAGAGGGGGGGGGGGGAGGGGTTTCGGGTTGTTGGTACAGAAATTTTGGGTGGAAACCCGGCGGGGGCAGCGCCCCACCCGGGGTTGTTTCGGGGGGGGTGGGTTTGTGGGTGTGTTTAGGGGGTTGCCCTTGCGGGGCCCGCCGGCCACCCCAACCACCAGAGGGGGCAGGTGGTCGGGGGGGGGGGGTGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCCAACCACAGGAT

Sequences - 3ʹ (reverse) EST

Accession: JZ838090
dbEST ID: 79655792
Trimmed Sequence: ACCAAAGACACTTTTTGCCGGGCCGGCCTTCGGCTTATCAAAAGCTGTTTCTCCGCCGGTCTTGTTCTGGCTGAACACAGAAGGGGCCATTGTTCCAGATTGTTCGCATTCCTTCATAACCTGGTATGTTTTGGATTTGATTGGGACTTGGTGGGCCAGCTTGTTTTTTGCTCCTTTAAGGTCTTCTTCCTTCATCGGAGGCCTCTTCTTCTTAACTGGGGCATCCTGTGGTTGGGACATGG
Full Trace Sequence: GGGGAATAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTNACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAAACCAAAGACACTTTTTGCCGGGCCGGCCTTCGGCTTATCAAAAGCTGTTTCTCCGCCGGTCTTGTTCTGGCTGAACACAGAAGGGGCCATTGTTCCAGATTGTTCGCATTCCTTCATAACCTGGTATGTTTTGGATTTGATTGGGACTTGGTGGGCCAGCTTGTTTTTTGCTCCTTTAAGGTCTTCTTCCTTCATCGGAGGCCTCTTCTTCTTAACTGGGGCATCCTGTGGTTGGGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGCGCCCGACCTTAATACTAAAAAATAAAATAAAACAAAAATGTACTAATCCCTTTTAAAGGAAAAGGAGAGCAAGGGGCAAAAATACCCGCTAAACAAAAGCGCGGGCGGGGCTTCTCTTTTTTGGGTGGGGGGCACCGGGCACGGGGGGGCCCTTCCTTGCGAGTGGGTAGAGAGGGGGTGAACACAATCCCCAGAAACCGACTCCCCCACGCGAAGCCAAATTGCAAGGGGTGGAGGGCGGCCGGGCTTATGGGGGTTAATTTAAAGTTATTTGTTTTGTTTGAAACCTTCCCCAGCGACACAGCTACCGGCGCCCCGGGGCGGCTGGTGTTGGGGGGTGGGGATACACATCTAGCCGAGCCCNCCCGGCCCCCCCGAGAGCCCCAAAANGAGGGGGGGGGGAGGGGGGGGGGGGAGANAANNNCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCAAAGACACTTTTTGCCG