ORFeome > mvb12a ORF1 – XORFeome v1.0

mvb12a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mvb12a
Gene ID: 6251626
Gene Page ID: 5895173
ORF Xenbase ID: 17285163

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043757
Original XGC clone length: 828

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ823804
dbEST ID: 79641506
Trimmed Sequence: ATGGAGAACAGTTCTACACCCATCACTGGATTGGCCTGGATATCTAGCGTCACTCTGTGTCCCAAGACCTACAATATGATTGTGGCAACGGTTGAAGGAGCCTCGGCCAACTTTGTTAAAGGCTTTAACCAGAAATCGGCTGTGTACCTTGGTTACAGCACAGTCCCAGAGGGTCTGGAGCAAGTTATCACTGACATTCAAATGCTGAATGAAAAGACAGTGCTGCCTGTTGGGTATGCTTTCATCGGGGAACACTTAGACCCAAAAATCTCTGTGCCAAAGAAAAAAAGGCTATGTGTAAAGCAGATGCCTATGCACACTGCAGAAACCGCTGTCTGTGAGATCAAATTATCCATGAAAAGCAAGCAGTTTGGTGCTCCATATGAACGCATTGGTGAAATAAGTGGATTGGTATTTTGGTGCAGAAAAGGCAGTGTGTCGGCTCCCAAACCTACTCCAAAACCTCGAAACATTACTTCTGGCATTAAAGGGCTTTCTCTTGACAGCAACACCGCAGTCCAACCAGTAAGACGAGCAAGTGCACCAAATCCAGATGCAGGACAAGCGGTTCCACTGAGTAATGGTAAATGGGGTTTGTCGGAGAATGCTATTTATGATTCTTCAAATATTTATGGCATATCTGCTATAGATGGGATCCCTTTTACAATTCACCCAATGTTTGAGAATACTATTAACAATTCTTCAGTGGCCGCCTCAGACTTCAGAGATCTACATATAAAGACTCTGTCTGAAGATTGAGAGTGAGTAACAACTATGGGATTTTGTGGTTTGAAAAAAACT
Full Trace Sequence: TATTGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGAACAGTTCTACACCCATCACTGGATTGGCCTGGATATCTAGCGTCACTCTGTGTCCCAAGACCTACAATATGATTGTGGCAACGGTTGAAGGAGCCTCGGCCAACTTTGTTAAAGGCTTTAACCAGAAATCGGCTGTGTACCTTGGTTACAGCACAGTCCCAGAGGGTCTGGAGCAAGTTATCACTGACATTCAAATGCTGAATGAAAAGACAGTGCTGCCTGTTGGGTATGCTTTCATCGGGGAACACTTAGACCCAAAAATCTCTGTGCCAAAGAAAAAAAGGCTATGTGTAAAGCAGATGCCTATGCACACTGCAGAAACCGCTGTCTGTGAGATCAAATTATCCATGAAAAGCAAGCAGTTTGGTGCTCCATATGAACGCATTGGTGAAATAAGTGGATTGGTATTTTGGTGCAGAAAAGGCAGTGTGTCGGCTCCCAAACCTACTCCAAAACCTCGAAACATTACTTCTGGCATTAAAGGGCTTTCTCTTGACAGCAACACCGCAGTCCAACCAGTAAGACGAGCAAGTGCACCAAATCCAGATGCAGGACAAGCGGTTCCACTGAGTAATGGTAAATGGGGTTTGTCGGAGAATGCTATTTATGATTCTTCAAATATTTATGGCATATCTGCTATAGATGGGATCCCTTTTACAATTCACCCAATGTTTGAGAATACTATTAACAATTCTTCAGTGGCCGCCTCAGACTTCAGAGATCTACATATAAAGACTCTGTCTGAAGATTGAGAGTGAGTAACAACTATGGGATTTTGTGGTTTGAAAAAAACT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAACAGTTCTACACCCATC

Sequences - 3ʹ (reverse) EST

Accession: JZ829114
dbEST ID: 79646816
Trimmed Sequence: ACGTAGCCGTGGTGGAATACGAGCCGCTGCAGTTTTTTCAACCACAAATCCATAGTTGTACTCACTCTCAATCTCAGACAGAGTCTTTATATGTAGATCTCTGAAGTCTGAGGCGGCCACTGAAGAATTGTTAATAGTATTCTCAAACATTGGGTGAATTGTAAAAGGGATCCCATCTATAGCAGATATGCCATAAATATTTGAAGAATCATAAATAGCATTCTCCGACAAACCCCATTTACCATTACTCAGTGGAACCGCTTGTCCTGCATCTGGATTTGGTGCACTTGCTCGTCTTACTGGTTGGACTGCGGTGTTGCTGTCAAGAGAAAGCCCTTTAATGCCAGAAGTAATGTTTCGAGGTTTTGGAGTAGGTTTGGGAGCCGACACACTGCCTTTTCTGCACCAAAATACCAATCCACTTATTTCACCAATGCGTTCATATGGAGCACCAAACTGCTTGCTTTTCATGGATAATTTGATCTCACAGACAGCGGTTTCTGCAGTGTGCATAGGCATCTGCTTTACACATAGCCTTTTTTTCTTTGGCACAGAGATTTTTGGGTCTAAGTGTTCCCCGATGAAAGCATACCCAACAGGCAGCACTGTCTTTTCATTCAGCATTTGGATGTCAGTGATAACTTGCTCCAGACCCTCTGGGACTGTGCTGTAACCAGGTAACCAGCCCAATTTCTGGTTAAAGCCTTTTAACAAATTGGGCCGAAGGTTCCTTCAACCTTTGCCCACAATCTTTAATGGTAGGGTTT
Full Trace Sequence: CCGAGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACGTAGCCGTGGTGGAATACGAGCCGCTGCAGTTTTTTCAACCACAAATCCATAGTTGTACTCACTCTCAATCTCAGACAGAGTCTTTATATGTAGATCTCTGAAGTCTGAGGCGGCCACTGAAGAATTGTTAATAGTATTCTCAAACATTGGGTGAATTGTAAAAGGGATCCCATCTATAGCAGATATGCCATAAATATTTGAAGAATCATAAATAGCATTCTCCGACAAACCCCATTTACCATTACTCAGTGGAACCGCTTGTCCTGCATCTGGATTTGGTGCACTTGCTCGTCTTACTGGTTGGACTGCGGTGTTGCTGTCAAGAGAAAGCCCTTTAATGCCAGAAGTAATGTTTCGAGGTTTTGGAGTAGGTTTGGGAGCCGACACACTGCCTTTTCTGCACCAAAATACCAATCCACTTATTTCACCAATGCGTTCATATGGAGCACCAAACTGCTTGCTTTTCATGGATAATTTGATCTCACAGACAGCGGTTTCTGCAGTGTGCATAGGCATCTGCTTTACACATAGCCTTTTTTTCTTTGGCACAGAGATTTTTGGGTCTAAGTGTTCCCCGATGAAAGCATACCCAACAGGCAGCACTGTCTTTTCATTCAGCATTTGGATGTCAGTGATAACTTGCTCCAGACCCTCTGGGACTGTGCTGTAACCAGGTAACCAGCCCAATTTCTGGTTAAAGCCTTTTAACAAATTGGGCCGAAGGTTCCTTCAACCTTTGCCCACAATCTTTAATGGTAGGGTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGTAGCCGTGGTGGAA