ORFeome > mybph ORF1 – XORFeome v1.0

mybph ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mybph
Gene ID: 1018436
Gene Page ID: 1018429
ORF Xenbase ID: 17285241

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054315
Original XGC clone length: 1533

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ839441
dbEST ID: 79657143
Trimmed Sequence: ATGCCAGCAAAGGCTCCAATTAAAAAGTCCCCAGCAGCTAAAGCTGCTCCAGGTAAACCACAGGCAGCTCCTGCGCCTGTGCCTGAGCCAGTCCAGGAAGTCCCTGTACCAGAAGTCCCTGTACCAGAAGCCCCTGTTCCTATTCCAGAACCTGTTGAGAATTCTGTTCCAGAGGCATCTGCACCACCCACAGAAACCCCAGCCCCAGAAACAGAAGTTTCTGTTCCAGCACCAGCTGCACCAGTTTCAGAACCAGAAAAGGCTCCTGAAGTAGTTGAAGAACCTCCACCTGAACCAGAAGCTTTAAAAGAAGAACCACCAAGTGAGCCTATAGAATTAACAGTGGATGAAATTGATGACACTTCGATATCCCTTAAATGGAAAGCTCCAGAAAAGGAAGGAACTGCTGCCCTGGATGGATACTTACTGGAATACCAAAAAGAAGGTCAAGAATGGATTGCTGTGAACAAAGAGCCAAGTGTTTCAACTCGCTACAAAATTCAGAATTTGAATACTGGTGATAAGGTCACTGTCCGTGTTACAGCAGTTAGCAAAGCAGGAAACAGTGCTCCAAGGGCACTTGAAAATTTTGTTCAAATTCGAGAAATTGTGGATCGTCCCAAAATCCGTCTTCCAAGGTACTTGCGTCAAACATTTGTGAAACATGTAANGAGAAGCAGTGAATCTGGTGATCCCGTTCCAGGGGAAGCCNAGACCTCAGGTCCATTGGACTAAAATGGGACACCTCTGGATCCAAAACATGCAAGTGTCAAAAAACATTGAGAAGTGAAACAATTCTTTTTTATCCCACTTGCCTAAAGCGAAAGGA
Full Trace Sequence: CCCACCAAATAATAGAATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCAGCAAAGGCTCCAATTAAAAAGTCCCCAGCAGCTAAAGCTGCTCCAGGTAAACCACAGGCAGCTCCTGCGCCTGTGCCTGAGCCAGTCCAGGAAGTCCCTGTACCAGAAGTCCCTGTACCAGAAGCCCCTGTTCCTATTCCAGAACCTGTTGAGAATTCTGTTCCAGAGGCATCTGCACCACCCACAGAAACCCCAGCCCCAGAAACAGAAGTTTCTGTTCCAGCACCAGCTGCACCAGTTTCAGAACCAGAAAAGGCTCCTGAAGTAGTTGAAGAACCTCCACCTGAACCAGAAGCTTTAAAAGAAGAACCACCAAGTGAGCCTATAGAATTAACAGTGGATGAAATTGATGACACTTCGATATCCCTTAAATGGAAAGCTCCAGAAAAGGAAGGAACTGCTGCCCTGGATGGATACTTACTGGAATACCAAAAAGAAGGTCAAGAATGGATTGCTGTGAACAAAGAGCCAAGTGTTTCAACTCGCTACAAAATTCAGAATTTGAATACTGGTGATAAGGTCACTGTCCGTGTTACAGCAGTTAGCAAAGCAGGAAACAGTGCTCCAAGGGCACTTGAAAATTTTGTTCAAATTCGAGAAATTGTGGATCGTCCCAAAATCCGTCTTCCAAGGTACTTGCGTCAAACATTTGTGAAACATGTAANGAGAAGCAGTGAATCTGGTGATCCCGTTCCAGGGGAAGCCNAGACCTCAGGTCCATTGGACTAAAATGGGACACCTCTGGATCCAAAACATGCAAGTGTCAAAAAACATTGAGAAGTGAAACAATTCTTTTTTATCCCACTTGCCTAAAGCGAAAGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCAGCAAAGGCTCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839440
dbEST ID: 79657142
Trimmed Sequence: CTGGGGCACTCTGACATCAAGTCTGCAGTCTACACTTGCTTCCCCTAATGAGTTGATTGCTTTACAGGTGTAAACTCCACCATCAAAAGGACAGGGCTTGCGAATTTCAAGAGAGCAGACTCCCTGATTAACAAGGCACCGGAATTTAGGGTCCTCTCTAATTTCCATTTGATTCTTTAGCCACACAATTTTGGGCTTTGGGCTTCCACGGACACAACAGAACAGTTTAGTACTGTATCCAGTTGTTGTTGCCCTATTAGCTAGCGCCTGGGTGAATTTTGGTGGCTCTGCAAAATCCCGATCCTTATACTCTGGGGGTGTATAAGTGATTCCAGTTTTCTTAATAAAAGCACAATCTTTAGTCACTGCAGCCTTTTCACTTAGGCCACACAAATTTTCTGAAAATACTCTGAAGAAATAAGAATTTCCCATGATCAGGTCTGAAACAGTGCAGTTAGTCTGGCGGTAATGCTCTTGTACAGTAAACCATTCCCCAGTTTTCTTGTCTGCCTTCTGCACAGTATATCCTGTAATATCTGAATTTCCATCATCAAGGTGGTGGGGTCCACTCCAAAGCTGCATTAAATCCCCAAGCATCCAGCAGCTTAATACTCTTTGGTGGCCCAGGGCGCTCAGCAATTTTTATCTCAATCTTGGCTTTATCCTCCAGCGTGTCATTTTGTACTGTCAGTTCCTATATTCCAGAGCCTTTACGCCTCACAGTTTCGGAAAAAAAAAAATATTGTCACCTCTTACTTGTTTCCTAAACCCT
Full Trace Sequence: AAAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGGGGCACTCTGACATCAAGTCTGCAGTCTACACTTGCTTCCCCTAATGAGTTGATTGCTTTACAGGTGTAAACTCCACCATCAAAAGGACAGGGCTTGCGAATTTCAAGAGAGCAGACTCCCTGATTAACAAGGCACCGGAATTTAGGGTCCTCTCTAATTTCCATTTGATTCTTTAGCCACACAATTTTGGGCTTTGGGCTTCCACGGACACAACAGAACAGTTTAGTACTGTATCCAGTTGTTGTTGCCCTATTAGCTAGCGCCTGGGTGAATTTTGGTGGCTCTGCAAAATCCCGATCCTTATACTCTGGGGGTGTATAAGTGATTCCAGTTTTCTTAATAAAAGCACAATCTTTAGTCACTGCAGCCTTTTCACTTAGGCCACACAAATTTTCTGAAAATACTCTGAAGAAATAAGAATTTCCCATGATCAGGTCTGAAACAGTGCAGTTAGTCTGGCGGTAATGCTCTTGTACAGTAAACCATTCCCCAGTTTTCTTGTCTGCCTTCTGCACAGTATATCCTGTAATATCTGAATTTCCATCATCAAGGTGGTGGGGTCCACTCCAAAGCTGCATTAAATCCCCAAGCATCCAGCAGCTTAATACTCTTTGGTGGCCCAGGGCGCTCAGCAATTTTTATCTCAATCTTGGCTTTATCCTCCAGCGTGTCATTTTGTACTGTCAGTTCCTATATTCCAGAGCCTTTACGCCTCACAGTTTCGGAAAAAAAAAAATATTGTCACCTCTTACTTGTTTCCTAAACCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGGGCACTCTGACATCAA