ORFeome > mycn ORF1 – XORFeome v1.0

mycn ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mycn
Gene ID: 478863
Gene Page ID: 478858
ORF Xenbase ID: 17285289

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043747
Original XGC clone length: 1320

Human orthology & disease relationships

NCBI Entrez ID: 4613
Ensembl gene IDs: ENSG00000134323
Directly associated (OMIM) disease MIM numbers: 164280
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: JZ823852
dbEST ID: 79641554
Trimmed Sequence: ATGCCAGGGTTGGTGAGCAGAAATATGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCAGACGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCACCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTCCCCACACCCCCTCTTTCCCCTAGCCGTTCTGGGCTGCACGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCAGTGGACTGGGCATCCGAGCTGTTACTGTTGCCTCCTGAAACTGATCTGCTTGGAGGTTCTAGCTGGGGAGAACTTGGATTGCCCCCCTGCAATGTAAAATCCTTCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGAGAAAAGCTAGAGAGGGCCGTCAGTGAGAAGCTGGGCAAGGCATCATGCACCCCAGAGCCAACCGTTCCTCATCCCCCTAGTTCAACAGTGGGCAGCTCTGTGTCAGGACGTGGGGTGGACATTAATAATCCGACGGCACATCATTGTGTTGATCCAGCCGTGGTGTTTCCATTCCCATTTAACAAGGGGGAGAGCTGCAGGACTGCCCCCAGCACTGCCAACCCTCCACCCTGTACAACCACAAATGTGCCAACAACCATAACAGCTAGGAATTGCACTCAGCCTTGCACCACCGGCTCCAGCTCTGGAGAGGAGAGCCACAGCGAATCCGATGACGATGATGATGACGAAAAAGAAGAAGAGGAGGAATGAAGAGAGGAAAAAAATGAATGTTGTCCCGTTGGGAGAAAAGGCGCAACTCCACCCAAAAAATCTTTTAAACGGTCCCTTTAAAATTTCC
Full Trace Sequence: TAATGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCAGGGTTGGTGAGCAGAAATATGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCAGACGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCACCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTCCCCACACCCCCTCTTTCCCCTAGCCGTTCTGGGCTGCACGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCAGTGGACTGGGCATCCGAGCTGTTACTGTTGCCTCCTGAAACTGATCTGCTTGGAGGTTCTAGCTGGGGAGAACTTGGATTGCCCCCCTGCAATGTAAAATCCTTCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGAGAAAAGCTAGAGAGGGCCGTCAGTGAGAAGCTGGGCAAGGCATCATGCACCCCAGAGCCAACCGTTCCTCATCCCCCTAGTTCAACAGTGGGCAGCTCTGTGTCAGGACGTGGGGTGGACATTAATAATCCGACGGCACATCATTGTGTTGATCCAGCCGTGGTGTTTCCATTCCCATTTAACAAGGGGGAGAGCTGCAGGACTGCCCCCAGCACTGCCAACCCTCCACCCTGTACAACCACAAATGTGCCAACAACCATAACAGCTAGGAATTGCACTCAGCCTTGCACCACCGGCTCCAGCTCTGGAGAGGAGAGCCACAGCGAATCCGATGACGATGATGATGACGAAAAAGAAGAAGAGGAGGAATGAAGAGAGGAAAAAAATGAATGTTGTCCCGTTGGGAGAAAAGGCGCAACTCCACCCAAAAAATCTTTTAAACGGTCCCTTTAAAATTTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCAGGGTTGGTGAGCAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829160
dbEST ID: 79646862
Trimmed Sequence: GCAAGTCCGCAAGCGTTCGATTTTCTTGAGCAACTGTTGTTGTCGGAGCTGCAGTTTCTCTTTTTCCAATAAGAGTTTCCGCTCGTCCTCATGCAGGGAATGAACGTAGTCAGTGGCTTTTTTTAGGATGACGACTTTAGCGGCTTTCTCGTTTTTAATGAGTTCTGGTACATGGTCCCTTAACGTCAGGAAACTCGACCTCAAGTCATTGCGCCGTTGTCGCTCCAGTATGTTGTGGTTTCGCCGTCTCTCGCTGTCCTCAGAGTCGTAATTGCGAGGACTGGAGCTTTTTGGCTTGGCAGGCACCACGCTCTTGACTAGGCGCGGCAACTCATTCTTCTGCTTCTTTTGAGGTGGAGCCACCTCTTCGGTTTCCGCGTATGGCGAGGGAGCTGCGTAATTGTGCTGCTGGTGAACTGGAGCGCTTCGCTTGAGGATCACCTCATTCTGAGCAGCCTTCGTTGACACCAAGATGGTATTCTTAGGTCGTACGGTGATTGTAAGGGACGTTACAGATTTGTTGGATGAGTTGCGCCTTTTCTCCACTGTGACAACATCAATTTCTTCCTCTTCTTCATCCTCCTCTTCTTCTTCTTCGTCATCATCATCGTCATCGGAATCGCTGTGGCTCTCCTCTCAGAGNCTGGAGCGGGTGGTGGCAAGCTGAGTGCAATTCCTAACTTGTATGTTTGTTGCCCCATTTGTGGTGGGAAAGGGGGGGGGAAGGGTTTGGGGAGGGCGTGGGGGGGCCATCCCCGGCCCCCCTTCC
Full Trace Sequence: GGACAGGGAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAAGTCCGCAAGCGTTCGATTTTCTTGAGCAACTGTTGTTGTCGGAGCTGCAGTTTCTCTTTTTCCAATAAGAGTTTCCGCTCGTCCTCATGCAGGGAATGAACGTAGTCAGTGGCTTTTTTTAGGATGACGACTTTAGCGGCTTTCTCGTTTTTAATGAGTTCTGGTACATGGTCCCTTAACGTCAGGAAACTCGACCTCAAGTCATTGCGCCGTTGTCGCTCCAGTATGTTGTGGTTTCGCCGTCTCTCGCTGTCCTCAGAGTCGTAATTGCGAGGACTGGAGCTTTTTGGCTTGGCAGGCACCACGCTCTTGACTAGGCGCGGCAACTCATTCTTCTGCTTCTTTTGAGGTGGAGCCACCTCTTCGGTTTCCGCGTATGGCGAGGGAGCTGCGTAATTGTGCTGCTGGTGAACTGGAGCGCTTCGCTTGAGGATCACCTCATTCTGAGCAGCCTTCGTTGACACCAAGATGGTATTCTTAGGTCGTACGGTGATTGTAAGGGACGTTACAGATTTGTTGGATGAGTTGCGCCTTTTCTCCACTGTGACAACATCAATTTCTTCCTCTTCTTCATCCTCCTCTTCTTCTTCTTCGTCATCATCATCGTCATCGGAATCGCTGTGGCTCTCCTCTCAGAGNCTGGAGCGGGTGGTGGCAAGCTGAGTGCAATTCCTAACTTGTATGTTTGTTGCCCCATTTGTGGTGGGAAAGGGGGGGGGAAGGGTTTGGGGAGGGCGTGGGGGGGCCATCCCCGGCCCCCCTTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAAGTCCGCAAGCGTT