ORFeome > myef2 ORF1 – XORFeome v1.0

myef2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: myef2
Gene ID: 866532
Gene Page ID: 854004
ORF Xenbase ID: 17285307

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108587
Original XGC clone length: 2022

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: JZ837988
dbEST ID: 79655690
Trimmed Sequence: ATGGCGGAGATCGATCAGCAAGATTCCCAGGACGCTCTGAACAGCAGTGATAGCCTGTGTGAGGACGCAAGTTTTGCGGAGGAATCAAACGGTGTCAAAAAAGGAAGGCCATTATACATCAAGAAACGCAGGACACGGAGGGGCCGTGGGAGGAAAACCCAGGCTCATACTCTAGCAAACATGGAGGCGCCGCAGAGAAGCAATCTGCCGAGCTATGCCGGTCGGAAAAGTTCTATGCGCACGGAGTGTGTCGGTGACAGAGAAAAAGAAGTTATAGAATTAAATAAATGTTTAAGGTAGACAGGTCCTGGATATATGTACCAAGTTACGACTAATCGCTCTGCAGCATGTATAAAACTGTTGATTCTCATTTTGAACACAGATATTCAGCGCTGATGTAATAGAGGTGCAACCTGTTCGCGCGGGTGGAAAAGCCCGAATTGGTAGTGCGATTACTCAGTGTAGTGGTTTTTTGGAAAAGCATGCTGGTGTGGATGCTTCAAAGAACGGCGTTTCTGAGTGTATGAAAAAAAGATTTGATTACAAAACCAGCAAAGCCCCTAAATGGGGAGAGGGAATGAGGGGCGATTGTAGTTCTAGGGAAGAGACGAGTTGGCTGGTCAGACGGGAGAAAATAAAGAAAAGACGGGGAAGGAAGTTGGAAGGGTGAAAAAAAAATCAGAGGGGGGGGGTGCAAAAGAGAGGGGAAAGAAAAAAACAAAAGAAACCGCGAAAGAATAAATCGGCGGAGGGGAAAAAAAAAAATAAAAAAGAGAAGAAAAGAAGGTGGAAAGAAGAAGGAAAGTAAACGTCTGCGTTG
Full Trace Sequence: TCGGGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGATCGATCAGCAAGATTCCCAGGACGCTCTGAACAGCAGTGATAGCCTGTGTGAGGACGCAAGTTTTGCGGAGGAATCAAACGGTGTCAAAAAAGGAAGGCCATTATACATCAAGAAACGCAGGACACGGAGGGGCCGTGGGAGGAAAACCCAGGCTCATACTCTAGCAAACATGGAGGCGCCGCAGAGAAGCAATCTGCCGAGCTATGCCGGTCGGAAAAGTTCTATGCGCACGGAGTGTGTCGGTGACAGAGAAAAAGAAGTTATAGAATTAAATAAATGTTTAAGGTAGACAGGTCCTGGATATATGTACCAAGTTACGACTAATCGCTCTGCAGCATGTATAAAACTGTTGATTCTCATTTTGAACACAGATATTCAGCGCTGATGTAATAGAGGTGCAACCTGTTCGCGCGGGTGGAAAAGCCCGAATTGGTAGTGCGATTACTCAGTGTAGTGGTTTTTTGGAAAAGCATGCTGGTGTGGATGCTTCAAAGAACGGCGTTTCTGAGTGTATGAAAAAAAGATTTGATTACAAAACCAGCAAAGCCCCTAAATGGGGAGAGGGAATGAGGGGCGATTGTAGTTCTAGGGAAGAGACGAGTTGGCTGGTCAGACGGGAGAAAATAAAGAAAAGACGGGGAAGGAAGTTGGAAGGGTGAAAAAAAAATCAGAGGGGGGGGGTGCAAAAGAGAGGGGAAAGAAAAAAACAAAAGAAACCGCGAAAGAATAAATCGGCGGAGGGGAAAAAAAAAAATAAAAAAGAGAAGAAAAGAAGGTGGAAAGAAGAAGGAAAGTAAACGTCTGCGTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGATCGATCAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837987
dbEST ID: 79655689
Trimmed Sequence: TGCGTTGCGGTCTAAACGGACATCGATCTCTCTGCCATTTATTTTCATGCCATTCATTAGTCTGCATGCCTTTTCTGCGGTTTCTGGACAGTCAAACCTTACTGTTCCACAGCCTTTGGACTTTCCGTTTTCCATTTTGATTTCAGCAAACATAACTCGACCACACTGATTAAATTTCTCTTTCAGTTTTTGCCAGGTTAAGTCAAAGGGCAGATTTCTTACAAATATTTGGCATCCTTTATACATTCCTCTATCTCTGGAACCACCACCCAACTGAGCAGATCCTTATCCTCCAAATCCTCCGTCCATATCCTTACTCCTGTCCAAACCACCCACTCTATCAAAGCTACTGCTCATTCGGTCCATACCACGTCCCATTGACATTGAATTCTCTAAGATACATTCCTTGTTCATTTCATAGCCCACAGGACCCATACCAGAATAGTCACTCCACCAACCCTTCGTCCAGGGCACCACCCTGTCGTACTACATAATCATCTTACCACGATTTTATGCCTTTTCTCTGCTACAATTTCTTCTTCATATACAACGGCTTCTCTCACCTTACTAGCTATAATCAGAACCGTCTGCACTAAAAAGCGTAAACAGTGCTTCGCATTCAAAAACGACTGTATTGGTNGCCAGTAGGCAGTAATAAAATATCAATACAAGGAACTAGAAGAAGAGGGCGCGAAAGGGCCAAAAAAAAAATAAAAAAAAAAATAGTGATATGATAGGAATCACAAAGCGGGGAGAGCCGGGGGCTCTTATTTTTA
Full Trace Sequence: AAAATGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCGTTGCGGTCTAAACGGACATCGATCTCTCTGCCATTTATTTTCATGCCATTCATTAGTCTGCATGCCTTTTCTGCGGTTTCTGGACAGTCAAACCTTACTGTTCCACAGCCTTTGGACTTTCCGTTTTCCATTTTGATTTCAGCAAACATAACTCGACCACACTGATTAAATTTCTCTTTCAGTTTTTGCCAGGTTAAGTCAAAGGGCAGATTTCTTACAAATATTTGGCATCCTTTATACATTCCTCTATCTCTGGAACCACCACCCAACTGAGCAGATCCTTATCCTCCAAATCCTCCGTCCATATCCTTACTCCTGTCCAAACCACCCACTCTATCAAAGCTACTGCTCATTCGGTCCATACCACGTCCCATTGACATTGAATTCTCTAAGATACATTCCTTGTTCATTTCATAGCCCACAGGACCCATACCAGAATAGTCACTCCACCAACCCTTCGTCCAGGGCACCACCCTGTCGTACTACATAATCATCTTACCACGATTTTATGCCTTTTCTCTGCTACAATTTCTTCTTCATATACAACGGCTTCTCTCACCTTACTAGCTATAATCAGAACCGTCTGCACTAAAAAGCGTAAACAGTGCTTCGCATTCAAAAACGACTGTATTGGTNGCCAGTAGGCAGTAATAAAATATCAATACAAGGAACTAGAAGAAGAGGGCGCGAAAGGGCCAAAAAAAAAATAAAAAAAAAAATAGTGATATGATAGGAATCACAAAGCGGGGAGAGCCGGGGGCTCTTATTTTTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCGTTGCGGTCTAAACGG