ORFeome > myf6 ORF1 – XORFeome v1.0

myf6 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: myf6
Gene ID: 998208
Gene Page ID: 998202
ORF Xenbase ID: 17285319

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084975
Original XGC clone length: 726

Human orthology & disease relationships

NCBI Entrez ID: 4618
Ensembl gene IDs: ENSG00000111046
Directly associated (OMIM) disease MIM numbers: 614408
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ839960
dbEST ID: 79657662
Trimmed Sequence: ATGATGGACCTATTTGAAACAAATTCCTATTTTTTTTACCTGGATGGAGATAATGGAGCCTTTCAACAACTGGGAGTAGCAGATGGATCCCCTGTCTACCCAGGTAGTGAGGGGACATTGTCCCCATGTCGTGATCAGCTGCCAGCAGATGCTGGAAGTGACAGTAGTGAAGAGGAACATGTCTTAGCTCCACCAGGACTACAACCCCACTGTCCTGGACAATGTCTAATCTGGGCCTGCAAGACCTGCAAAAGAAAGTCTGCCCCAACTGACAGAAGAAAAGCAGCCACCCTAAGGGAAAGGAGAAGGCTAAAGAAGATCAATGAAGCTTTTGAGGCTCTCAAAAGAAGGACTGTGGCAAACCCAAACCAAAGACTTCCCAAAGTTGAAATACTACGCAGTGCCATTAATTATATCGAAAGGCTCCAGGATCTGTTGCACAGTTTGGATCAGCAGGACAAGCCACAGAAAGCAGATGAGGAACCCTTCTCCTATAACCCCAAAGAGGCTTCTATTCAGAGTGAGGATTTCTTAAGTACCTGTCATCCTGAGTGGCACCATATTCCCGACCATTTCCGAATGCCCGATCTCAATATTAAAGAAAAAAGATCCCCTACCGGAGAATTCCTCCTCCAGCAGCCTGCATTGCCCCCCCCCATAGTGGACGGCAATCTTCTGAAGAACCCGGGCCCCCTTGCACCATACAAGAACCGGGGAAAAAATTTGGCACCTTTTCTTGTACAAAGTTGGGCATTTAAAAAAAGCAATTGTCTAAACATTTTTGTTTCCACCCAACAAGGGTCCAATAA
Full Trace Sequence: CGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGGACCTATTTGAAACAAATTCCTATTTTTTTTACCTGGATGGAGATAATGGAGCCTTTCAACAACTGGGAGTAGCAGATGGATCCCCTGTCTACCCAGGTAGTGAGGGGACATTGTCCCCATGTCGTGATCAGCTGCCAGCAGATGCTGGAAGTGACAGTAGTGAAGAGGAACATGTCTTAGCTCCACCAGGACTACAACCCCACTGTCCTGGACAATGTCTAATCTGGGCCTGCAAGACCTGCAAAAGAAAGTCTGCCCCAACTGACAGAAGAAAAGCAGCCACCCTAAGGGAAAGGAGAAGGCTAAAGAAGATCAATGAAGCTTTTGAGGCTCTCAAAAGAAGGACTGTGGCAAACCCAAACCAAAGACTTCCCAAAGTTGAAATACTACGCAGTGCCATTAATTATATCGAAAGGCTCCAGGATCTGTTGCACAGTTTGGATCAGCAGGACAAGCCACAGAAAGCAGATGAGGAACCCTTCTCCTATAACCCCAAAGAGGCTTCTATTCAGAGTGAGGATTTCTTAAGTACCTGTCATCCTGAGTGGCACCATATTCCCGACCATTTCCGAATGCCCGATCTCAATATTAAAGAAAAAAGATCCCCTACCGGAGAATTCCTCCTCCAGCAGCCTGCATTGCCCCCCCCCATAGTGGACGGCAATCTTCTGAAGAACCCGGGCCCCCTTGCACCATACAAGAACCGGGGAAAAAATTTGGCACCTTTTCTTGTACAAAGTTGGGCATTTAAAAAAAGCAATTGTCTAAACATTTTTGTTTCCACCCAACAAGGGTCCAATAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGGACCTATTTGAAAC

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTCTCTACCAGCTCCTGTATAGTGCAAGGGTGCTTGGGTTCATCAGAAGATATGCTGTCCACTATAGAGGAGAGGCACTGCAGGCTGCTGGAGGAGGAATTCTCCTGTAGGGATCTTTCTTCTTTAATATTGAGATCGGGCATTCTGGAATGGTCGGGAATATGGTGCCACTCAGGATGACAGGTACTTAAGAAATCCTCACTCTGAATAGAAGCCTCTTTGGGGTTATAGGAGAAGGGTTCCTCATCTGCTTTCTGTGGCTTGTCCTGCTGATCCAAACTGTGCAACAGATCCTGGAGCCTTTCGATATAATTAATGGCACTGCGTAGTATTTCAACTTTGGGAAGTCTTTGGTTTGGGTTTGCCACACTCCTTCTTTTGAGAGCCTCAAAAGCTTCATTGATCTTCTTTAGCCTTCTCCTTTCCCTTACGGTGGCTGGTTTTCTTCTGTCANTTGTGGCAGACTTTCTTTTGCAGGTCTGGGAGGCGCGGAGTTAACATTGTCCGCGACGTTGGGATTGTAGTCGTGATTCTACTAAAACATATTCATCGTCACACTGTCACTTGCAGCATCTGCTGGCACCTCAAGCAGAAATGGGGACAATGTCCCCGTCACTCCCCTGGGTAAACGGGGGAACCATCGGCAACTCCGGGNTTGTAAGAGGGGGTCGAAAAAGGCGCGCCGGGGGGAAGAGGGGGGGAGGGTGAATTAAAAATAGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTCTCTACCAGCTCCTGTAT