ORFeome > myl1 ORF1 – XORFeome v1.0

myl1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: myl1
Gene ID: 970341
Gene Page ID: 970332
ORF Xenbase ID: 17285331

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041529
Original XGC clone length: 573

Human orthology & disease relationships

NCBI Entrez ID: 4632
Ensembl gene IDs: ENSG00000168530
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 115196,124900,146800,153640,153650,155100,192600,194050,215600,253300,253400,253550,266140,300436,300558,600334,600652,603278,603622,603689,604145,605249,608807,608808,609322

Library Location

Plate ID: GDExl11013
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: JZ824048
dbEST ID: 79641750
Trimmed Sequence: ATGGCACCCAAGAAGGATGTGAAGAAACCTGAGGCTAAACCCGCTGCTGCCGCAGCACCAGCTCCAGCCCCAGAACCAGAAAAGCCCAAAGCACCTGCATTTGATCTGTCCAGTGTTAAGATCGAGTTTTCTCAGGATCAACAGGATGACTTCAAAGAGGCTTTCCTGCTCTTTGACAGGACAGGAGACAGCAAAATCGCTCTCAACCAGGTTGCTGATGTGATGAGAGCTCTGGGACAGAACCCCACAAATGCTGAGGTCAAGAAGATCCTGGGCAACCCCAGTGCTGAGGAGATGAACGCCAAGAGGATTGAGTTTGAGCAGTTCCTGCCCATGTTGCAGGCCATTGCCAACAACAAGGACCAGGGCTCATTTGAAGACTTTGTTGAGGGTCTCCGTGTCTTTGACAAGGAAGGCAACGGCACAGTTATGGGTGCTGAGCTTCGTCACGTACTGGCCACTCTGGGTGAGAAGATGAGGGAGGAGGAAGTAGAATCTCTCCTGGCTGGTCAGGAAGACTCCAACGGCTGTATCAACTATGAAGCCTTTGTGAAACACATCATGTCCGTCTT
Full Trace Sequence: ACAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCACCCAAGAAGGATGTGAAGAAACCTGAGGCTAAACCCGCTGCTGCCGCAGCACCAGCTCCAGCCCCAGAACCAGAAAAGCCCAAAGCACCTGCATTTGATCTGTCCAGTGTTAAGATCGAGTTTTCTCAGGATCAACAGGATGACTTCAAAGAGGCTTTCCTGCTCTTTGACAGGACAGGAGACAGCAAAATCGCTCTCAACCAGGTTGCTGATGTGATGAGAGCTCTGGGACAGAACCCCACAAATGCTGAGGTCAAGAAGATCCTGGGCAACCCCAGTGCTGAGGAGATGAACGCCAAGAGGATTGAGTTTGAGCAGTTCCTGCCCATGTTGCAGGCCATTGCCAACAACAAGGACCAGGGCTCATTTGAAGACTTTGTTGAGGGTCTCCGTGTCTTTGACAAGGAAGGCAACGGCACAGTTATGGGTGCTGAGCTTCGTCACGTACTGGCCACTCTGGGTGAGAAGATGAGGGAGGAGGAAGTAGAATCTCTCCTGGCTGGTCAGGAAGACTCCAACGGCTGTATCAACTATGAAGCCTTTGTGAAACACATCATGTCCGTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGGTCTCAAAAAATTCTTTAAAAGTGAAAAANNNNNNGGGNNNACTCCGCGCGCCCTNTTTTATTCCGTCTTCTCTCTTTTTTTTCTGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACCCAAGAAGGATGTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829358
dbEST ID: 79647060
Trimmed Sequence: GACGGACATGATGTGTTTCACAAAGGCTTCATAGTTGATACAGCCGTTGGAGTCTTCCTGACCAGCCAGGAGAGATTCTACTTCCTCCTCCCTCATCTTCTCACCCAGAGTGGCCAGTACGTGACGAAGCTCAGCACCCATAACTGTGCCGTTGCCTTCCTTGTCAAAGACACGGAGACCCTCAACAAAGTCTTCAAATGAGCCCTGGTCCTTGTTGTTGGCAATGGCCTGCAACATGGGCAGGAACTGCTCAAACTCAATCCTCTTGGCGTTCATCTCCTCAGCACTGGGGTTGCCCAGGATCTTCTTGACCTCAGCATTTGTGGGGTTCTGTCCCAGAGCTCTCATCACATCAGCAACCTGGTTGAGAGCGATTTTGCTGTCTCCTGTCCTGTCAAAGAGCAGGAAAGCCTCTTTGAAGTCATCCTGTTGATCCTGAGAAAACTCGATCTTAACACTGGACAGATCAGATGCAGGTGCTTTGGGCTTTTCTGGTTCTGGGGCTGGAGCTGGGTGCTGGCGCAGCAACGGGGTTAGCCTCAGGTTTCGTCACATCCTTCTTGGGGGGCCAGGCTGGCCAATTTTTGGGACCAAAGTTGGGCATTATAAAAAGGCATTGCTCATCAGTTTGGTGGGACCAAAAGGGCCCCTATCAGTCAAAAAAAAAATCAATAAAAAGGGCCCCGACCCTAACAACCTGGGCGTGCGGTTTTCAGGCCCCTCCAGGGACGGGGGGAAGTTTGCCAGGGGTGGTTGTTTGCTGG
Full Trace Sequence: GGGCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACGGACATGATGTGTTTCACAAAGGCTTCATAGTTGATACAGCCGTTGGAGTCTTCCTGACCAGCCAGGAGAGATTCTACTTCCTCCTCCCTCATCTTCTCACCCAGAGTGGCCAGTACGTGACGAAGCTCAGCACCCATAACTGTGCCGTTGCCTTCCTTGTCAAAGACACGGAGACCCTCAACAAAGTCTTCAAATGAGCCCTGGTCCTTGTTGTTGGCAATGGCCTGCAACATGGGCAGGAACTGCTCAAACTCAATCCTCTTGGCGTTCATCTCCTCAGCACTGGGGTTGCCCAGGATCTTCTTGACCTCAGCATTTGTGGGGTTCTGTCCCAGAGCTCTCATCACATCAGCAACCTGGTTGAGAGCGATTTTGCTGTCTCCTGTCCTGTCAAAGAGCAGGAAAGCCTCTTTGAAGTCATCCTGTTGATCCTGAGAAAACTCGATCTTAACACTGGACAGATCAGATGCAGGTGCTTTGGGCTTTTCTGGTTCTGGGGCTGGAGCTGGGTGCTGGCGCAGCAACGGGGTTAGCCTCAGGTTTCGTCACATCCTTCTTGGGGGGCCAGGCTGGCCAATTTTTGGGACCAAAGTTGGGCATTATAAAAAGGCATTGCTCATCAGTTTGGTGGGACCAAAAGGGCCCCTATCAGTCAAAAAAAAAATCAATAAAAAGGGCCCCGACCCTAACAACCTGGGCGTGCGGTTTTCAGGCCCCTCCAGGGACGGGGGGAAGTTTGCCAGGGGTGGTTGTTTGCTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACGGACATGATGTGTTTCACAA