ORFeome > myl2 ORF1 – XORFeome v1.0

myl2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: myl2
Gene ID: 864827
Gene Page ID: 482090
ORF Xenbase ID: 17285337

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078537
Original XGC clone length: 504

Human orthology & disease relationships

NCBI Entrez ID: 4633
Ensembl gene IDs: ENSG00000111245,LRG_393
Directly associated (OMIM) disease MIM numbers: 608758
Indirectly associated (Lage, et al.) disease MIM numbers: 123320,192600,207800,207900,215700,311250,601419,604765,606072,607801,608758

Library Location

Plate ID: GDExl11004
Well Location: F08

Sequences - 5ʹ (forward) EST

Accession: JZ839630
dbEST ID: 79657332
Trimmed Sequence: ATGTCACCCAAGAAAGCAAAGAAGAGATCAGAGGGGGGCAGCTCTAATGTGTTCTCCATGTTTGAGCAAACACAGATCCAGGAATTTAAAGAGGCTTTTACTATTATGGACCAGAACCGAGATGGATTCATTGACAAAGATGATCTGAGAGATACTTTTGCTGCATTAGGTCGACTGAATGTAAAAAATGAGGAACTGGATGAGATGCTAAAAGAAGCTCCAGGACCAATCAACTTTACAGTGTTCCTGACTATGTTTGGCGAGAAGTTAAAGGGAGCTGATCCAGAAGAAACAATTCTAAATGCGTTCAAAGTGTTTGATCCCGAGGGCATTGGACTTCTAAAATCAGAATACATTCGAGAAATGCTCATGACTCAGGCAGAAAGATTTACAAGCGAAGAGGTGGATCAGATGTTCACAGCTTTCCCCCCTGACGTGACTGGAAATTTAAACTACAAAAACCTTGTGCATATTATCACTCACGGTGAAGAGAAGGAGGAATT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCACCCAAGAAAGCAAAGAAGAGATCAGAGGGGGGCAGCTCTAATGTGTTCTCCATGTTTGAGCAAACACAGATCCAGGAATTTAAAGAGGCTTTTACTATTATGGACCAGAACCGAGATGGATTCATTGACAAAGATGATCTGAGAGATACTTTTGCTGCATTAGGTCGACTGAATGTAAAAAATGAGGAACTGGATGAGATGCTAAAAGAAGCTCCAGGACCAATCAACTTTACAGTGTTCCTGACTATGTTTGGCGAGAAGTTAAAGGGAGCTGATCCAGAAGAAACAATTCTAAATGCGTTCAAAGTGTTTGATCCCGAGGGCATTGGACTTCTAAAATCAGAATACATTCGAGAAATGCTCATGACTCAGGCAGAAAGATTTACAAGCGAAGAGGTGGATCAGATGTTCACAGCTTTCCCCCCTGACGTGACTGGAAATTTAAACTACAAAAACCTTGTGCATATTATCACTCACGGTGAAGAGAAGGAGGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGGTCAAAAATGAATCCTGGCAGCTCTGGCCCGTGTCTCAAATCCCATTAAAGGTTAAACGNNNNGNGTTTGTGTGTCCCGGGGGTTGGGGGGGTTCTTTTTCTTGTGGTGTTGGGGGGGGCGCCCCCTCGGGGTTTTCCCCCTTTCTCTCGTGGTGTGGGCTTTTGGGCTTTTGTGTTGCCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCACCCAAGAAAGCAAAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839629
dbEST ID: 79657331
Trimmed Sequence: TTCCTCCTTCTCTTCACCGTGAGTGATAATATGCACAAGGTTTTTGTAGTTTAAATTTCCAGTCACGTCAGGGGGGAAAGCTGTGAACATCTGATCCACCTCTTCGCTTGTAAATCTTTCTGCCTGAGTCATGAGCATTTCTCGAATGTATTCTGATTTTAGAAGTCCAATGCCCTCGGGATCAAACACTTTGAACGCATTTAGAATTGTTTCTTCTGGATCAGCTCCCTTTAACTTCTCGCCAAACATAGTCAGGAACACTGTAAAGTTGATTGGTCCTGGAGCTTCTTTTAGCATCTCATCCAGTTCCTCATTTTTTACATTCAGTCGACCTAATGCAGCAAAAGTATCTCTCAGATCATCTTTGTCAATGAATCCATCTCGGTTCTGGTCCATAATAGTAAAAGCCTCTTTAAATTCCTGGATCTGTGTTTGCTCAAACATGGAGAACACATTAGAGCTGCCCCCCTCTGATCTCTTCTTTGCTTTCTTGGGTGACATGG
Full Trace Sequence: GGGGAATACGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCCTCCTTCTCTTCACCGTGAGTGATAATATGCACAAGGTTTTTGTAGTTTAAATTTCCAGTCACGTCAGGGGGGAAAGCTGTGAACATCTGATCCACCTCTTCGCTTGTAAATCTTTCTGCCTGAGTCATGAGCATTTCTCGAATGTATTCTGATTTTAGAAGTCCAATGCCCTCGGGATCAAACACTTTGAACGCATTTAGAATTGTTTCTTCTGGATCAGCTCCCTTTAACTTCTCGCCAAACATAGTCAGGAACACTGTAAAGTTGATTGGTCCTGGAGCTTCTTTTAGCATCTCATCCAGTTCCTCATTTTTTACATTCAGTCGACCTAATGCAGCAAAAGTATCTCTCAGATCATCTTTGTCAATGAATCCATCTCGGTTCTGGTCCATAATAGTAAAAGCCTCTTTAAATTCCTGGATCTGTGTTTGCTCAAACATGGAGAACACATTAGAGCTGCCCCCCTCTGATCTCTTCTTTGCTTTCTTGGGTGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAAAAGGTCACCATCAGTCAAAAATAAATAATTAATTAGAAGCCAGAGCTTAATACTGCCCGTCATTTACACGCGCCGGAAAACAGAGAAATAAGGCTACCCCAGGTTGCCGGGCTATCTATTCAGGGGTTAGGTTGGAAGGGACGACCTCGTGGGAAAAGAACATTTCCCGGGGAAAGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCTCCTTCTCTTCACC