ORFeome > myl3 ORF1 – XORFeome v1.0

myl3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: myl3
Gene ID: 6255788
Gene Page ID: 946569
ORF Xenbase ID: 17285343

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099306
Original XGC clone length: 567

Human orthology & disease relationships

NCBI Entrez ID: 4634
Ensembl gene IDs: ENSG00000160808,LRG_395
Directly associated (OMIM) disease MIM numbers: 608751
Indirectly associated (Lage, et al.) disease MIM numbers: 124900,153640,153650,155100,192600,215600,253300,253400,253550,300436,300558,600334,600652,603278,603622,603689,604145,605249,608751,608807,608808,609285,609322

Library Location

Plate ID: GDExl11006
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ840096
dbEST ID: 79657798
Trimmed Sequence: ATGCCACCCAAAAAGCCTGAGCCAAAGAAGGAAGAACCCAAGCCTGTAGCCAAACCTCCAGAGCCCGAGCCACCCAAGGAGCCTTTGTTTGACCCCTCCACTGTCACAATTGAATTCAGTGCAGATCAAATTGAAGAATTTAAGGAAGCCTTTTCCCTCTTTGATCGGACCCCTAATTGTGAGCAAAAAATCACCTATGGACAGTGTGGAGACGTCCTGCGAGCTTTGGGACAGAATCCAACCAATGCAGAAGTTTTAAAAGTCCTTGGCAAGCCAAAAACTGAAGAATTAAACGTTAAGATGATGGATTTTGATACCTTCCTGCCCATGCTCCAACACATTTCCAAGTCGAAGGAGAAGGGGATATATGAAGACTTTGTTGAAGGGCTGCGTGTGTTTGATAAGGAAGGAAATGGTACTGTAATGGGAGCTGAAATCCGTCACGTCTTGGCTACTCTAGGGGAAAGAATGACAGAAGAAGAGGTAGACAGGTTACTGCATGGGCAAGAAGAGTCCAATGGCAACATCAACTATGAAGCCTTTGCAAAGTACATCTTGGGCAACTT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCACCCAAAAAGCCTGAGCCAAAGAAGGAAGAACCCAAGCCTGTAGCCAAACCTCCAGAGCCCGAGCCACCCAAGGAGCCTTTGTTTGACCCCTCCACTGTCACAATTGAATTCAGTGCAGATCAAATTGAAGAATTTAAGGAAGCCTTTTCCCTCTTTGATCGGACCCCTAATTGTGAGCAAAAAATCACCTATGGACAGTGTGGAGACGTCCTGCGAGCTTTGGGACAGAATCCAACCAATGCAGAAGTTTTAAAAGTCCTTGGCAAGCCAAAAACTGAAGAATTAAACGTTAAGATGATGGATTTTGATACCTTCCTGCCCATGCTCCAACACATTTCCAAGTCGAAGGAGAAGGGGATATATGAAGACTTTGTTGAAGGGCTGCGTGTGTTTGATAAGGAAGGAAATGGTACTGTAATGGGAGCTGAAATCCGTCACGTCTTGGCTACTCTAGGGGAAAGAATGACAGAAGAAGAGGTAGACAGGTTACTGCATGGGCAAGAAGAGTCCAATGGCAACATCAACTATGAAGCCTTTGCAAAGTACATCTTGGGCAACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAAAAGGTCACTATCAGTCAAAATAAAATCATTATTTGGCATCCCGCTGAAATCCCCCTATAGTGGAGTCGTAATACATGGGTCCTAACTTGTTATCAGGAAAAAACATGACCCGTGGTCCAAACAATCCAAAGAAGGAATAAAAANGCNGGNNNNNGGGGGCNGNNCTTCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCACCCAAAAAGCCTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ840095
dbEST ID: 79657797
Trimmed Sequence: GTTTGCCAAGATGTACTTTGCAAAGGCTTCATAGTTGATGTTGCCATTGGACTCTTCTTGCCCATGCAGTAACCTGTCTACCTCTTCTTCTGTCATTCTTTCCCCTAGAGTAGCCAAGACGTGACGGATTTCAGCTCCCATTACAGTACCATTTCCTTCCTTATCAAACACACGCAGCCCTTCAACAAAGTCTTCATATATCCCCTTCTCCTTCGACTTGGAAATGTGTTGGAGCATGGGCAGGAAGGTATCAAAATCCATCATCTTAACGTTTAATTCTTCAGTTTTTGGCTTGCCAAGGACTTTTAAAACTTCTGCATTGGTTGGATTCTGTCCCAAAGCTCGCAGGACGTCTCCACACTGTCCATAGGTGATTTTTTGCTCACAATTAGGGGTCCGATCAAAGAGGGAAAAGGCTTCCTTAAATTCTTCAATTTGATCTGCACTGAATTCAATTGTGACAGTGGAGGGGTCAAACAAAGGCTCCTTGGGTGGCTCGGGGCTCTGGAGGTTTGGCTACGAGCTTGGGTTCTTCCTTCTTTGGCTCAGGCTTTTGGGGTGGGATGG
Full Trace Sequence: GGGAAACGGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTTGCCAAGATGTACTTTGCAAAGGCTTCATAGTTGATGTTGCCATTGGACTCTTCTTGCCCATGCAGTAACCTGTCTACCTCTTCTTCTGTCATTCTTTCCCCTAGAGTAGCCAAGACGTGACGGATTTCAGCTCCCATTACAGTACCATTTCCTTCCTTATCAAACACACGCAGCCCTTCAACAAAGTCTTCATATATCCCCTTCTCCTTCGACTTGGAAATGTGTTGGAGCATGGGCAGGAAGGTATCAAAATCCATCATCTTAACGTTTAATTCTTCAGTTTTTGGCTTGCCAAGGACTTTTAAAACTTCTGCATTGGTTGGATTCTGTCCCAAAGCTCGCAGGACGTCTCCACACTGTCCATAGGTGATTTTTTGCTCACAATTAGGGGTCCGATCAAAGAGGGAAAAGGCTTCCTTAAATTCTTCAATTTGATCTGCACTGAATTCAATTGTGACAGTGGAGGGGTCAAACAAAGGCTCCTTGGGTGGCTCGGGGCTCTGGAGGTTTGGCTACGAGCTTGGGTTCTTCCTTCTTTGGCTCAGGCTTTTGGGGTGGGATGGTGGCAACGTATTTGTACAAGGTTGGGATTATAAAAAAGCATTGGCCATCCATTTTTTGGCAACAAACAGTTTCCCATCAGGTCGAATGAAATTCATAAATTAAAAAAAAGAAATTAAAAAACGGGGCGCCGGGTTAAAAAGAGGGGAGAAGGGGGAGGGGGGGGCGGGGCTAGCCAATGGAACGAGGGGATGGGGGAGCTGTTGGTGTTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTGCCAAGATGTACTTTGC