ORFeome > mylpf ORF1 – XORFeome v1.0

mylpf ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mylpf
Gene ID: 969369
Gene Page ID: 969362
ORF Xenbase ID: 17285373

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053808
Original XGC clone length: 513

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ839566
dbEST ID: 79657268
Trimmed Sequence: ATGGCACCAGCAAAGAAGGCCAAGAGAAGGGCAGCAGAAGGTGGATCTTCCAATGTGTTGTCCATGTTTGACCAAACCCAGATCCAGGAGTTCAAGGAGGCTTTCACAGTGATTGATCAGAACAGAGACGGCATCATTGACAAGGAAGACCTGAGGGACACATTCGCAGCTATGGGCCGCGTGAACGTGAAGAATGAAGAGTTGGAAGAGATGGTCAAAGAGGCATCTGGACCCATCAACTTCACCGTCTTCCTGACCATGTTTGGAGAGAAGCTCAAGGGTGCTGATCCCGAAGACGTTATCACTGGGGCATTCAAGGTGCTTGATCCTGAGGCCAAAGGATCCATCAAGAAGCAGTTCCTTGAGGAACTCCTGACCACACAGTGTGACAGATTCACCCCAGACGAGATCAAGAACATGTGGACAGCGTTCCCCCCTGATGTTGCTGGCAACGTAGACTACAAGAACATCTGTTATGTCATCACCCACGGAGAGGACAAAGACCAGGAATT
Full Trace Sequence: TCGCGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCACCAGCAAAGAAGGCCAAGAGAAGGGCAGCAGAAGGTGGATCTTCCAATGTGTTGTCCATGTTTGACCAAACCCAGATCCAGGAGTTCAAGGAGGCTTTCACAGTGATTGATCAGAACAGAGACGGCATCATTGACAAGGAAGACCTGAGGGACACATTCGCAGCTATGGGCCGCGTGAACGTGAAGAATGAAGAGTTGGAAGAGATGGTCAAAGAGGCATCTGGACCCATCAACTTCACCGTCTTCCTGACCATGTTTGGAGAGAAGCTCAAGGGTGCTGATCCCGAAGACGTTATCACTGGGGCATTCAAGGTGCTTGATCCTGAGGCCAAAGGATCCATCAAGAAGCAGTTCCTTGAGGAACTCCTGACCACACAGTGTGACAGATTCACCCCAGACGAGATCAAGAACATGTGGACAGCGTTCCCCCCTGATGTTGCTGGCAACGTAGACTACAAGAACATCTGTTATGTCATCACCCACGGAGAGGACAAAGACCAGGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACAAAAAAAAAAACCTGAAAACATGAAAACTCTGGCCCCTGTCTCAAACCAAAAAAAAAAAAAAAAAACAAAAAAAAAAAGAAACCAGGGAGAAGGGGGGGCCCCCCTCTTTGGAAGGTGGAAGGGGGGGAAAACCCTCCGGGAAAAAAAACCATTTTCCTCCGGGGAAGCGGAAAGATAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACCAGCAAAGAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839565
dbEST ID: 79657267
Trimmed Sequence: TTCCTGGTCTTTGTCCTCTCCGTGGGTGATGACATAACAGATGTTCTTGTAGTCTACGTTGCCAGCAACATCAGGGGGGAACGCTGTCCACATGTTCTTGATCTCGTCTGGGGTGAATCTGTCACACTGTGTGGTCAGGAGTTCCTCAAGGAACTGCTTCTTGATGGATCCTTTGGCCTCAGGATCAAGCACCTTGAATGCCCCAGTGATAACGTCTTCGGGATCAGCACCCTTGAGCTTCTCTCCAAACATGGTCAGGAAGACGGTGAAGTTGATGGGTCCAGATGCCTCTTTGACCATCTCTTCCAACTCTTCATTCTTCACGTTCACGCGGCCCATAGCTGCGAATGTGTCCCTCANGTCTTCCTTGTCAATGATGCCGTCTCTGTTCTGATCAATCACTGTGAAAGCCTCCTTGAACTCCTGGATCTGGGTTTGGTCAAACATGGACAACACATTGGAAGATCCACCTTCTGCTGCCCTTCTCTTGGCCTTCTTTGCTGGTGCCATGG
Full Trace Sequence: GAAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCCTGGTCTTTGTCCTCTCCGTGGGTGATGACATAACAGATGTTCTTGTAGTCTACGTTGCCAGCAACATCAGGGGGGAACGCTGTCCACATGTTCTTGATCTCGTCTGGGGTGAATCTGTCACACTGTGTGGTCAGGAGTTCCTCAAGGAACTGCTTCTTGATGGATCCTTTGGCCTCAGGATCAAGCACCTTGAATGCCCCAGTGATAACGTCTTCGGGATCAGCACCCTTGAGCTTCTCTCCAAACATGGTCAGGAAGACGGTGAAGTTGATGGGTCCAGATGCCTCTTTGACCATCTCTTCCAACTCTTCATTCTTCACGTTCACGCGGCCCATAGCTGCGAATGTGTCCCTCANGTCTTCCTTGTCAATGATGCCGTCTCTGTTCTGATCAATCACTGTGAAAGCCTCCTTGAACTCCTGGATCTGGGTTTGGTCAAACATGGACAACACATTGGAAGATCCACCTTCTGCTGCCCTTCTCTTGGCCTTCTTTGCTGGTGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCATCATTTTGTTGCAACCAAACAGGTCACTATCCATTCAAAATAAAAATAGTAAAAAAACGGCCCCAAACTTAAAAACTGGCCCTCGTTTACACGGGGCAGGAATGCCCGGACTTTAAGGGCTCCACGGGGAGGCGGGGGGCCTCCCCTTGTGGGAATCGTAGAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCTGGTCTTTGTCCTCT