ORFeome > myo5a ORF1 – XORFeome v1.0

myo5a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: myo5a
Gene ID: 1004105
Gene Page ID: 1004101
ORF Xenbase ID: 17285427

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045050
Original XGC clone length: 1785

Human orthology & disease relationships

NCBI Entrez ID: 4644
Ensembl gene IDs: ENSG00000197535,LRG_86
Directly associated (OMIM) disease MIM numbers: 214450
Indirectly associated (Lage, et al.) disease MIM numbers: 104300,114480,114500,124900,125800,125853,148700,161800,162210,172700,173100,191100,193520,209950,214450,219050,233710,256710,260540,262400,262650,266600,274500,301000,303600,313900,600274,600652,600802,601104,601665,603278,603622,604370,605249,607341,607485,607684,607734,607785,608751,609135,609227

Library Location

Plate ID: GDExl11014
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ824133
dbEST ID: 79641835
Trimmed Sequence: ATGGAAAACAATTTAGATTTTGCTTATGTTACACACGCAAGGGTCTGGATCCCTGACCCTGAGGAAGTATGGAAATCTGCAGAGATGCTCAAGGACTACAAGCCTGGAGACACTGTTCTTCGGTTACGTCTGGAGGAAGGCACGGATTTGGAATATCGCCTCGATGCCAAGACAAAGGAACTCCCCCCTCTGAGAAACCCAGACATCCTTGTGGGAGAGAATGACCTCACAGCCCTGAGTTATCTCCACGAGCCAGCCGTTCTCCACAATTTGAAAGTACGATTTATAGACTCCAAACTCATTTATACATACTGCGGCATTGTTCTCGTAGCTATAAACCCCTATGAGCAGTTACCCATCTATGGCACCGACATCATTAATGCGTACAGTGGGCAGAATATGGGGGACATGGATCCCCATATTTTTGCAGTGGCAGAAGAAGCATATAAACAAATGGCCAGGGATGAGCGCAATCAGTCGATTATTGTGAGTGGAGAATCTGGAGCTGGGAAGACTGTCTCTGCCAAGTATGCTATGAGATACTTTGCAACTGTCAGTGGTTCTGCCAGTGAAACAAACGTTGAAGAGAAAGTGTTGGCCTCCAATCCCATCATGGAGTCTATAGGTAATGCTAAAACCACAAGGAATGATAACAGCAGTCGCTTTGGCAAATACATTGAAATTGGCTTTGATAACGCTACAGGATTCTGGNTGCCCACATGAGAACCCTATTGCTGGAAAAATCTAGAGTGGGTGTTTCAGGCTGAAGAAGAAGAGGATTTATCACATCTTTTTATCAGCGTTGGGGCATCTGCCTTTCTTTACCTTGAAT
Full Trace Sequence: CCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAAACAATTTAGATTTTGCTTATGTTACACACGCAAGGGTCTGGATCCCTGACCCTGAGGAAGTATGGAAATCTGCAGAGATGCTCAAGGACTACAAGCCTGGAGACACTGTTCTTCGGTTACGTCTGGAGGAAGGCACGGATTTGGAATATCGCCTCGATGCCAAGACAAAGGAACTCCCCCCTCTGAGAAACCCAGACATCCTTGTGGGAGAGAATGACCTCACAGCCCTGAGTTATCTCCACGAGCCAGCCGTTCTCCACAATTTGAAAGTACGATTTATAGACTCCAAACTCATTTATACATACTGCGGCATTGTTCTCGTAGCTATAAACCCCTATGAGCAGTTACCCATCTATGGCACCGACATCATTAATGCGTACAGTGGGCAGAATATGGGGGACATGGATCCCCATATTTTTGCAGTGGCAGAAGAAGCATATAAACAAATGGCCAGGGATGAGCGCAATCAGTCGATTATTGTGAGTGGAGAATCTGGAGCTGGGAAGACTGTCTCTGCCAAGTATGCTATGAGATACTTTGCAACTGTCAGTGGTTCTGCCAGTGAAACAAACGTTGAAGAGAAAGTGTTGGCCTCCAATCCCATCATGGAGTCTATAGGTAATGCTAAAACCACAAGGAATGATAACAGCAGTCGCTTTGGCAAATACATTGAAATTGGCTTTGATAACGCTACAGGATTCTGGNTGCCCACATGAGAACCCTATTGCTGGAAAAATCTAGAGTGGGTGTTTCAGGCTGAAGAAGAAGAGGATTTATCACATCTTTTTATCAGCGTTGGGGCATCTGCCTTTCTTTACCTTGAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAAACAATTTAGATTTTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829440
dbEST ID: 79647142
Trimmed Sequence: TCTTGGAACAACTCTGTTAGCAGTGTAAATTGCTTTCAGTACTTTAATTTGTTCTTCAAATACTGTATCTTTGTTCTTTTCCAGAAAACCATCACACTGATACTCTACCTTGTCGGCAAAGTGTTTAATAATAAAAGCCACATTAGACAGACGCGGCTTTTCAAATAATGCACATTTCTTAAGATGAGTATTGTATAACTTCTGTGCCCATGTGCTGTCTGAGCCTTTGGGCATCTTGCATTCTTCATCAAGAAGATCCAGAATACCCATTTTTGCCTCAATGAGATTGATACAAGGCTGGTTATCATAAAAATCAATTAATGTCCATGGAATTTGCTCCTTCATATATTCTTCTTGCTCCAACTTGAAAACATGCAAATTAAACTGTTGCTGGAGTTTCTCATTCGCATAGTTGATACAAAACTGTTCAAAGCTGTTGATTTCAAAGGTTTCAAACCCGTATATATCCAGGACTCCAATAAACGAATTCTGCTTTGTTGAGGAAAGAAGAGCTTTGTTGACATGACACACAATCCAGTTAAATAAGAAAGCATAGATGTGTTTAGCCAGGGCATCTCTGGCATTGGTGGCTTGTAATCTGGAAATGGGCTTGATGTAGGTCTCAGCAACAGTTAACAACCTTCTTGTGACACAGCCAATGAAGACTTCTCTTTCATAATCCACACCCATCCAAAACACAAAAAATAGATAAGGGGGTACCGGGGTTTTTGGGGGGAATTAAAAAAGCCTTATCTTAAAATCCCG
Full Trace Sequence: TGGCTGGTAGCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTTGGAACAACTCTGTTAGCAGTGTAAATTGCTTTCAGTACTTTAATTTGTTCTTCAAATACTGTATCTTTGTTCTTTTCCAGAAAACCATCACACTGATACTCTACCTTGTCGGCAAAGTGTTTAATAATAAAAGCCACATTAGACAGACGCGGCTTTTCAAATAATGCACATTTCTTAAGATGAGTATTGTATAACTTCTGTGCCCATGTGCTGTCTGAGCCTTTGGGCATCTTGCATTCTTCATCAAGAAGATCCAGAATACCCATTTTTGCCTCAATGAGATTGATACAAGGCTGGTTATCATAAAAATCAATTAATGTCCATGGAATTTGCTCCTTCATATATTCTTCTTGCTCCAACTTGAAAACATGCAAATTAAACTGTTGCTGGAGTTTCTCATTCGCATAGTTGATACAAAACTGTTCAAAGCTGTTGATTTCAAAGGTTTCAAACCCGTATATATCCAGGACTCCAATAAACGAATTCTGCTTTGTTGAGGAAAGAAGAGCTTTGTTGACATGACACACAATCCAGTTAAATAAGAAAGCATAGATGTGTTTAGCCAGGGCATCTCTGGCATTGGTGGCTTGTAATCTGGAAATGGGCTTGATGTAGGTCTCAGCAACAGTTAACAACCTTCTTGTGACACAGCCAATGAAGACTTCTCTTTCATAATCCACACCCATCCAAAACACAAAAAATAGATAAGGGGGTACCGGGGTTTTTGGGGGGAATTAAAAAAGCCTTATCTTAAAATCCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTTGGAACAACTCTGTTAGCA