ORFeome > myod1 ORF1 – XORFeome v1.0

myod1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: myod1
Gene ID: 1017506
Gene Page ID: 1017497
ORF Xenbase ID: 17285433

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041190
Original XGC clone length: 870

Human orthology & disease relationships

NCBI Entrez ID: 4654
Ensembl gene IDs: ENSG00000129152
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101400,130650,142946,151623,166600,174900,175050,180750,180849,245590,260350,609192

Library Location

Plate ID: GDExl11009
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ823754
dbEST ID: 79641456
Trimmed Sequence: ATGGAGCTGTTGCCCCCACCACTGCGGGACATGGAAGTCACTGAGGGATCTCTCTGCGCCTTCCCGACCCCCGACGACTTCTACGACGACCCCTGTTTCAATACCTCAGACATGAGTTTCTTTGAAGACCTGGACCCCAGGCTGGTGCACGTGACTCTTCTGAAACCAGAGGAACCCCACCATAACGAGGATGAGCACGTGAGGGCCCCCAGTGGGCACCATCAGGCTGGCAGGTGCTTGTTGTGGGCATGCAAAGCCTGTAAGAGAAAGACAACCAATGCCGACAGGAGGAAGGCCGCCACTATGAGGGAGAGAAGGAGACTCAGCAAGGTCAATGAAGCGTTTGAGACCCTGAAGCGATACACCTCAACTAACCCCAACCAAAGGCTCCCCAAAGTGGAGATCCTGCGCAACGCGATTCGCTACATAGAGAGCCTCCAGTCTCTGCTCCACGACCAGGATGAGGCTTTCTACCCGGTTCTGGAACATTACAGTGGGGACTCAGATGCCTCAAGCCCCAGGTCCAACTGCTCCGATGGCATGATGGATTATAACAGCCCCCCCTGCGGCTCCAGGAGAAGGAACAGCTACGACAGCAGCTTCTACAGTGACAGCCCAAATGACTCGAGACTTGGGAAAAGTTCAGTGATCTCCAGCCTTGACTGCCTCTCCAGCATCGTAGAGCGGATCTCCACCCAAAGCCCCAGCTGCCCCGTCCCCACAGCTGTGAATAGTGGATCCGAGGGCAGTCCCTGTTCTCCCCTGCAGGGGGGAGACATTTGAACGAAAGAAGTAATCCACCATC
Full Trace Sequence: CAGTATTGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCTGTTGCCCCCACCACTGCGGGACATGGAAGTCACTGAGGGATCTCTCTGCGCCTTCCCGACCCCCGACGACTTCTACGACGACCCCTGTTTCAATACCTCAGACATGAGTTTCTTTGAAGACCTGGACCCCAGGCTGGTGCACGTGACTCTTCTGAAACCAGAGGAACCCCACCATAACGAGGATGAGCACGTGAGGGCCCCCAGTGGGCACCATCAGGCTGGCAGGTGCTTGTTGTGGGCATGCAAAGCCTGTAAGAGAAAGACAACCAATGCCGACAGGAGGAAGGCCGCCACTATGAGGGAGAGAAGGAGACTCAGCAAGGTCAATGAAGCGTTTGAGACCCTGAAGCGATACACCTCAACTAACCCCAACCAAAGGCTCCCCAAAGTGGAGATCCTGCGCAACGCGATTCGCTACATAGAGAGCCTCCAGTCTCTGCTCCACGACCAGGATGAGGCTTTCTACCCGGTTCTGGAACATTACAGTGGGGACTCAGATGCCTCAAGCCCCAGGTCCAACTGCTCCGATGGCATGATGGATTATAACAGCCCCCCCTGCGGCTCCAGGAGAAGGAACAGCTACGACAGCAGCTTCTACAGTGACAGCCCAAATGACTCGAGACTTGGGAAAAGTTCAGTGATCTCCAGCCTTGACTGCCTCTCCAGCATCGTAGAGCGGATCTCCACCCAAAGCCCCAGCTGCCCCGTCCCCACAGCTGTGAATAGTGGATCCGAGGGCAGTCCCTGTTCTCCCCTGCAGGGGGGAGACATTTGAACGAAAGAAGTAATCCACCATC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCTGTTGCCCCCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829063
dbEST ID: 79646765
Trimmed Sequence: TAAGACGTGATAGATGGTGCTGCTGGGGTCCTGGGACAGTTGAGTGCAGGTATTGCTGGGAGAAGGGATGGTGATTACTCTCTCGCTCAATGTCTCCCCCTGCAGGGGAGAACAGGGACTGCCCTCGGATCCACTATCCACAGCTGTGGGGACGGGGCAGCTGGGGCTTTGGGTGGAGATCCGCTCTACGATGCTGGAGAGGCAGTCAAGGCTGGAGATCACTGAACTTTTCCCAAGTCTCGAGTCATTTGGGCTGTCACTGTAGAAGCTGCTGTCGTAGCTGTTCCTTCTCCTGGAGCCGCAGGGGGGGCTGTTATAATCCATCATGCCATCGGAGCAGTTGGACCTGGGGCTTGAGGCATCTGAGTCCCCACTGTAATGTTCCAGAACCGGGTAGAAAGCCTCATCCTGGTCGTGGAGCAGAGACTGGAGGCTCTCTATGTAGCGAATCGCGTTGCGCAGGATCTCCACTTTGGGGAGCCTTTGGTTGGGGTTAGTTGAGGTGTATCGCTTCAGGGTCTCAAACGCTTCATTGACCTTGCTGAGTCTCCTTCTCTCCCTCATAGTGGCGGCCTTCCTCCTGTCGGCATTGGTTGTCTTTCTCTTACAGGCTTTGCATGCCCACAACAAGCACCTGCCANCCTGATGGTGCCCACTGGGGGGCCCTCACGTGCTCATCCTCGGTTATGGTGGGGGTTCCTCTGGTTTTCAGAAAAAGTCACGTTGCCACCAACCCTGGGGGGCCCAAGGGTCTTTCAAAAAAAACC
Full Trace Sequence: CGGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAAGACGTGATAGATGGTGCTGCTGGGGTCCTGGGACAGTTGAGTGCAGGTATTGCTGGGAGAAGGGATGGTGATTACTCTCTCGCTCAATGTCTCCCCCTGCAGGGGAGAACAGGGACTGCCCTCGGATCCACTATCCACAGCTGTGGGGACGGGGCAGCTGGGGCTTTGGGTGGAGATCCGCTCTACGATGCTGGAGAGGCAGTCAAGGCTGGAGATCACTGAACTTTTCCCAAGTCTCGAGTCATTTGGGCTGTCACTGTAGAAGCTGCTGTCGTAGCTGTTCCTTCTCCTGGAGCCGCAGGGGGGGCTGTTATAATCCATCATGCCATCGGAGCAGTTGGACCTGGGGCTTGAGGCATCTGAGTCCCCACTGTAATGTTCCAGAACCGGGTAGAAAGCCTCATCCTGGTCGTGGAGCAGAGACTGGAGGCTCTCTATGTAGCGAATCGCGTTGCGCAGGATCTCCACTTTGGGGAGCCTTTGGTTGGGGTTAGTTGAGGTGTATCGCTTCAGGGTCTCAAACGCTTCATTGACCTTGCTGAGTCTCCTTCTCTCCCTCATAGTGGCGGCCTTCCTCCTGTCGGCATTGGTTGTCTTTCTCTTACAGGCTTTGCATGCCCACAACAAGCACCTGCCANCCTGATGGTGCCCACTGGGGGGCCCTCACGTGCTCATCCTCGGTTATGGTGGGGGTTCCTCTGGTTTTCAGAAAAAGTCACGTTGCCACCAACCCTGGGGGGCCCAAGGGTCTTTCAAAAAAAACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAGACGTGATAGATGGTGCTG