ORFeome > myoz1 ORF1 – XORFeome v1.0

myoz1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: myoz1
Gene ID: 6254058
Gene Page ID: 987356
ORF Xenbase ID: 17285451

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054224
Original XGC clone length: 936

Human orthology & disease relationships

NCBI Entrez ID: 58529
Ensembl gene IDs: ENSG00000177791
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,115200,253700,273800,300376,302045,310200,601287,601419,601954,604286,606685,607487,609452,609524

Library Location

Plate ID: GDExl11002
Well Location: E07

Sequences - 5ʹ (forward) EST

Accession: JZ839256
dbEST ID: 79656958
Trimmed Sequence: ATGCCACTGGCAGGAACCCCAGCTCCAAACAAGAGGAAAAAGTCAACCAAAGTCATCATGGCGATAAATCCATCAAGAGAAGGAGAGATAGAAATCTCCAAACTGAATTTAGGGAAAAAGATCAGTATTCCCAGGGATATCATGTTGGAAGAACTCTCCTTGCTCAGTAACAAAGGATCGAAGATGTTTAAACTTCGTCAAAAGAGGGTGGAAAAATTTATATATGAAAACAACCCTGATGTATTTTCTGACAATTCTTTGGACCACTTCCAGAAATTCATACCAACTGTTGGTGGGCAGTTAGGGGTTGGAGGCCAGTCAGGTATTGGAGGAGGTGGCTATGGATTGCTACATGGCAGCGGTCAAATGCTGTCCAGTATTTCGGGGGGACATCGTGGATCTGGTGGTCAGCAACCTCCTGTACCTCCACCAAAGCCTGGAAGTAAGAATGCTCTTGGAGGCCAGTCTGGAACTGGAGGAAGTGGTGGAAAAGATTCTGGGGTTGTTGATGGTACTCAAGGAAAAGAAGGCCAGTCTGGTCAGCGGGATGGAGGAAGCGGGAAGCAAATCACTGTCTTTAAGACATACCTCTCACCCTGGGACAAAGCTATGGGTGTTGATCCAAAGCAACCAACAAATATTACTGTTAATTTACTAAAAGTTTGGCAAAAAGGCAGACCTTTGCCAAATATAAATCATTTTAACAGGAATGGCTAGGCCTTTTGGTGGGGTATAAAAAACCATCCAAGCTTAATGATTTTTCCAAAATGCCAAAATTTTTTAATGCTTGCACCCTCCCGAAAACCTGGAATTCTGGTGTT
Full Trace Sequence: GGGGGCCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCACTGGCAGGAACCCCAGCTCCAAACAAGAGGAAAAAGTCAACCAAAGTCATCATGGCGATAAATCCATCAAGAGAAGGAGAGATAGAAATCTCCAAACTGAATTTAGGGAAAAAGATCAGTATTCCCAGGGATATCATGTTGGAAGAACTCTCCTTGCTCAGTAACAAAGGATCGAAGATGTTTAAACTTCGTCAAAAGAGGGTGGAAAAATTTATATATGAAAACAACCCTGATGTATTTTCTGACAATTCTTTGGACCACTTCCAGAAATTCATACCAACTGTTGGTGGGCAGTTAGGGGTTGGAGGCCAGTCAGGTATTGGAGGAGGTGGCTATGGATTGCTACATGGCAGCGGTCAAATGCTGTCCAGTATTTCGGGGGGACATCGTGGATCTGGTGGTCAGCAACCTCCTGTACCTCCACCAAAGCCTGGAAGTAAGAATGCTCTTGGAGGCCAGTCTGGAACTGGAGGAAGTGGTGGAAAAGATTCTGGGGTTGTTGATGGTACTCAAGGAAAAGAAGGCCAGTCTGGTCAGCGGGATGGAGGAAGCGGGAAGCAAATCACTGTCTTTAAGACATACCTCTCACCCTGGGACAAAGCTATGGGTGTTGATCCAAAGCAACCAACAAATATTACTGTTAATTTACTAAAAGTTTGGCAAAAAGGCAGACCTTTGCCAAATATAAATCATTTTAACAGGAATGGCTAGGCCTTTTGGTGGGGTATAAAAAACCATCCAAGCTTAATGATTTTTCCAAAATGCCAAAATTTTTTAATGCTTGCACCCTCCCGAAAACCTGGAATTCTGGTGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCACTGGCAGGAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839255
dbEST ID: 79656957
Trimmed Sequence: GAGTTCTTCTGTTTCTCCATCCATAGGCACAGCAATATCAATGGTGTAGTTTGTGTTATCACCCGATCCTAGCCATCCAATTGGGGTCCTGTTGAAAGAAGGTCTGTTGGTGATATCTTGATTGATGACAATCACAGACTCAGGTTCTGGAGGTGCAGCATCAAAATCTGGCATCTGGAAAATCATAAGCTTGGATGCTTTCTCATACCCACCAAAAGGCATAGCACTCCTGTTAAATGACTTATATTTGCAAAGGTCTGCCTTTTTGCCAAACTCTAGTAAATTAACAGTAATATTTGTTGGTTGCTTTGGATCAACACCCATAGCTTTGTCCCAGGGTGAGAGGTATGTCTTAAAGACAGTGATTTGCTTCCCGCTTCCTCCATCCCGCTGACCAGACTGGCCTTCTTTTCCTTGAGTACCATCAACAACCCCAGAATCTTTTCCACCACTTCCTCCAGTTCCAGACTGGCCTCCAAGAGCATTCTTACTTCCAGGCTTTGGTGGAGGTACAGGAGGTTGCTGACCACCAGATCCACGATGTCCCCCCGAAATACTGGACAGCATTTGACCGCTGCCATGTAGCATTCCATAGCCACCTCCTCCAATACCTGACTGGCCTCCACCCCCTAACTGCCCACCAACAGTTGGTATGAATTCCTTGAAATGGTCCAAAAAATTGGCCGAAAATAACATCAGGGTTTGTTTTCATAATTTAAATTTTTTCCACCCTTCTTTTTGACCAAAATTTTTAAAACATCTTTTCAAATC
Full Trace Sequence: CCGGGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAGTTCTTCTGTTTCTCCATCCATAGGCACAGCAATATCAATGGTGTAGTTTGTGTTATCACCCGATCCTAGCCATCCAATTGGGGTCCTGTTGAAAGAAGGTCTGTTGGTGATATCTTGATTGATGACAATCACAGACTCAGGTTCTGGAGGTGCAGCATCAAAATCTGGCATCTGGAAAATCATAAGCTTGGATGCTTTCTCATACCCACCAAAAGGCATAGCACTCCTGTTAAATGACTTATATTTGCAAAGGTCTGCCTTTTTGCCAAACTCTAGTAAATTAACAGTAATATTTGTTGGTTGCTTTGGATCAACACCCATAGCTTTGTCCCAGGGTGAGAGGTATGTCTTAAAGACAGTGATTTGCTTCCCGCTTCCTCCATCCCGCTGACCAGACTGGCCTTCTTTTCCTTGAGTACCATCAACAACCCCAGAATCTTTTCCACCACTTCCTCCAGTTCCAGACTGGCCTCCAAGAGCATTCTTACTTCCAGGCTTTGGTGGAGGTACAGGAGGTTGCTGACCACCAGATCCACGATGTCCCCCCGAAATACTGGACAGCATTTGACCGCTGCCATGTAGCATTCCATAGCCACCTCCTCCAATACCTGACTGGCCTCCACCCCCTAACTGCCCACCAACAGTTGGTATGAATTCCTTGAAATGGTCCAAAAAATTGGCCGAAAATAACATCAGGGTTTGTTTTCATAATTTAAATTTTTTCCACCCTTCTTTTTGACCAAAATTTTTAAAACATCTTTTCAAATC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGTTCTTCTGTTTCTCCATCC