ORFeome > myoz2 ORF1 – XORFeome v1.0

myoz2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: myoz2
Gene ID: 942891
Gene Page ID: 942885
ORF Xenbase ID: 17285457

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082908
Original XGC clone length: 801

Human orthology & disease relationships

NCBI Entrez ID: 51778
Ensembl gene IDs: ENSG00000172399,LRG_396
Directly associated (OMIM) disease MIM numbers: 613838
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,115200,253700,273800,300376,302045,310200,601287,601419,601954,604286,606685,607487,609452,609524

Library Location

Plate ID: GDExl11004
Well Location: G04

Sequences - 5ʹ (forward) EST

Accession: JZ839751
dbEST ID: 79657453
Trimmed Sequence: ATGTTGTCACAAAGTGCCCTCAACAAGGAGAGGAGAGAGCAAGCATCGGCCATTTTGAAGGAAATCCAAGGAAATGCTGGAAATGAGTCAGATGGCTTGGACTTTGGGAAAAAGATCAGCGTCCCACGGGACATTATGCTTGAGGAGTTATCCCACGTCAATAACCGCGGTGCGAGACTTTTTAAGATGCGTCAGAGGAGATCGGACAAGTATACATTTGAAAATTTTCCATATGCAATGAAGCCACAGACAGCTCAAAATCAAGTCAATCAAAATGGAAACACAGAAGGAAATACATTGGATGCCAACCAGCAAATCTCTCCACAGACACCTCCTAACACACCAGATCCTCGCAGTCCTCCCAACCCTGAAAACATTGCACCAGGATATACAGGCCCACTCAAAGAAATACCCCCAGAGAAGTTCAATGAAACTGCTGTTCCTAAGTATTATATGTCTCCATGGCTAGAAGCCATCAGCAATGAACCAGAACTCCTTGAGGCCCTGTACCCCAAATTGCCTGTACCTGGGCTAAAGGATGAGATTCCTGACTACAAGAGCTTCAACAGAGCTGCCACTCCTTTTGGGGGATTTGAAAATGCATCANAACGAACCACTTTCAAGCTCCCTGAGTTTGATCTATCTCCNATGATTGATCCTGCTGGTCATATGTCACCAAACCCTCTGAACACAAGACGATCCTTTTAACGAAAGGGCTCAGGGATGGGCATCTGAAAAACATCCCTATCCTTTTCTTTCGACCCCCTTCCCCCAAGTGCCTGAATTTCCGGAAATCCTGAAGAATCTGGTTGCCCAC
Full Trace Sequence: TCGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGTCACAAAGTGCCCTCAACAAGGAGAGGAGAGAGCAAGCATCGGCCATTTTGAAGGAAATCCAAGGAAATGCTGGAAATGAGTCAGATGGCTTGGACTTTGGGAAAAAGATCAGCGTCCCACGGGACATTATGCTTGAGGAGTTATCCCACGTCAATAACCGCGGTGCGAGACTTTTTAAGATGCGTCAGAGGAGATCGGACAAGTATACATTTGAAAATTTTCCATATGCAATGAAGCCACAGACAGCTCAAAATCAAGTCAATCAAAATGGAAACACAGAAGGAAATACATTGGATGCCAACCAGCAAATCTCTCCACAGACACCTCCTAACACACCAGATCCTCGCAGTCCTCCCAACCCTGAAAACATTGCACCAGGATATACAGGCCCACTCAAAGAAATACCCCCAGAGAAGTTCAATGAAACTGCTGTTCCTAAGTATTATATGTCTCCATGGCTAGAAGCCATCAGCAATGAACCAGAACTCCTTGAGGCCCTGTACCCCAAATTGCCTGTACCTGGGCTAAAGGATGAGATTCCTGACTACAAGAGCTTCAACAGAGCTGCCACTCCTTTTGGGGGATTTGAAAATGCATCANAACGAACCACTTTCAAGCTCCCTGAGTTTGATCTATCTCCNATGATTGATCCTGCTGGTCATATGTCACCAAACCCTCTGAACACAAGACGATCCTTTTAACGAAAGGGCTCAGGGATGGGCATCTGAAAAACATCCCTATCCTTTTCTTTCGACCCCCTTCCCCCAAGTGCCTGAATTTCCGGAAATCCTGAAGAATCTGGTTGCCCAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGTCACAAAGTGCCC

Sequences - 3ʹ (reverse) EST

Accession: JZ839750
dbEST ID: 79657452
Trimmed Sequence: CAGATCATCAGATTCAGGAATTTCAGCACTGAGGATGGGGTCAGAAGAAAAGATAGGGATGTTTTCAGATGCCCATCCCTGAGCCATTCTGTTAAAGGATCGTCTTGTGTTCAGAGGGTTTGGTGACATATTGACAGCAGGATCAATCATTGGAGATAGATCAAACTCAGGGAGCTTGAAAGTGGTTCGTTTTGATGCATTTTCAAATCCCCCAAAAGGAGTGGCAGCTCTGTTGAAGCTCTTGTAGTCAGGAATCTCATCCTTTAGCCCAGGTACAGGCAATTTGGGGTACAGGGCCTCAAGGAGTTCTGGTTCATTGCTGATGGCTTCTAGCCATGGAGACATATAATACTTAGGAACAGCAGTTTCATTGAACTTCTCTGGGGGTATTTCTTTGAGTGGGCCTGTATATCCTGGTGCAATGTTTTCAGGGTTGGGAGGACTGCGAGGATCTGGTGTGTTAGGAGGTGTCTGTGGAGAGATTTGCTGGTTGGCATCCAATGTATTTCCTTCTGTGTTTCCATTTTGATTGACTTGATTTTGAGCTGTCGGTGGCTTCATTGCATATGGAAAATTTTCCAATGTATACTTGTCCCATCTCCTCCTAACCATCTAAAAAAGTCTCGGACCGCGCGGTATGGGGTGGGAATTCTCCCTCAGGAAAGGAGGTCGGGGGGGGAGCCTAAAGCGTTTTCCCCAAAGTCCCAGGCCGGTTTAACCCAGTTTTCGAACAATTTGCCGTGGGAATTCCGCGGTCAAAATTGGCC
Full Trace Sequence: GGCAATATGCTAGTGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGATCATCAGATTCAGGAATTTCAGCACTGAGGATGGGGTCAGAAGAAAAGATAGGGATGTTTTCAGATGCCCATCCCTGAGCCATTCTGTTAAAGGATCGTCTTGTGTTCAGAGGGTTTGGTGACATATTGACAGCAGGATCAATCATTGGAGATAGATCAAACTCAGGGAGCTTGAAAGTGGTTCGTTTTGATGCATTTTCAAATCCCCCAAAAGGAGTGGCAGCTCTGTTGAAGCTCTTGTAGTCAGGAATCTCATCCTTTAGCCCAGGTACAGGCAATTTGGGGTACAGGGCCTCAAGGAGTTCTGGTTCATTGCTGATGGCTTCTAGCCATGGAGACATATAATACTTAGGAACAGCAGTTTCATTGAACTTCTCTGGGGGTATTTCTTTGAGTGGGCCTGTATATCCTGGTGCAATGTTTTCAGGGTTGGGAGGACTGCGAGGATCTGGTGTGTTAGGAGGTGTCTGTGGAGAGATTTGCTGGTTGGCATCCAATGTATTTCCTTCTGTGTTTCCATTTTGATTGACTTGATTTTGAGCTGTCGGTGGCTTCATTGCATATGGAAAATTTTCCAATGTATACTTGTCCCATCTCCTCCTAACCATCTAAAAAAGTCTCGGACCGCGCGGTATGGGGTGGGAATTCTCCCTCAGGAAAGGAGGTCGGGGGGGGAGCCTAAAGCGTTTTCCCCAAAGTCCCAGGCCGGTTTAACCCAGTTTTCGAACAATTTGCCGTGGGAATTCCGCGGTCAAAATTGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGATCATCAGATTCAGGAATTTC