ORFeome > naa20 ORF1 – XORFeome v1.0

naa20 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: naa20
Gene ID: 6078268
Gene Page ID: 969862
ORF Xenbase ID: 17285517

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044290
Original XGC clone length: 537

Human orthology & disease relationships

NCBI Entrez ID: 51126
Ensembl gene IDs: ENSG00000173418
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 203100,210200,222765,243500,248600,268300,606952,608643

Library Location

Plate ID: GDExl11013
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ824052
dbEST ID: 79641754
Trimmed Sequence: ATGACAACGCTGAGAGCTTTCACGTGTGATGATCTGTTTCGATTTAATAACATCAACTTGGATCCACTAACTGAGACTTATGGCATTCCTTTTTACCTGCAGTATTTGGCACACTGGCCCGAATATTTTATTGTTGCAGAGGCACCAGGTGGAGAACTCATGGGCTACATAATGGGAAAAGCCGAGGGTTCAGTAGCACGAGAGGAATGGCATGGGCACGTCACTGCTCTGTCTGTTGCTCCAGAATTCCGACGTCTTGGGCTGGCAGCTAAACTGATGGAATTACTAGAAGAAATTTCTGAAAGAAAAGGAGGATTTTTTGTTGATTTGTTTGTAAGAGTCTCCAATCAAGTTGCAGTGAATATGTACAAGCAGCTGGGATACAGTGTCTATCGAACTGTCATAGAGTATTACTCAGCCAGCAATGGGGAGCCGGATGAAGATGCGTACGACATGAGAAAAGCTCTATCAAGAGACACAGAGAAGAAGTCTATCGTACCTCTACCACATCCTGTGAGACCAGAAGACATTGAATT
Full Trace Sequence: TGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAACGCTGAGAGCTTTCACGTGTGATGATCTGTTTCGATTTAATAACATCAACTTGGATCCACTAACTGAGACTTATGGCATTCCTTTTTACCTGCAGTATTTGGCACACTGGCCCGAATATTTTATTGTTGCAGAGGCACCAGGTGGAGAACTCATGGGCTACATAATGGGAAAAGCCGAGGGTTCAGTAGCACGAGAGGAATGGCATGGGCACGTCACTGCTCTGTCTGTTGCTCCAGAATTCCGACGTCTTGGGCTGGCAGCTAAACTGATGGAATTACTAGAAGAAATTTCTGAAAGAAAAGGAGGATTTTTTGTTGATTTGTTTGTAAGAGTCTCCAATCAAGTTGCAGTGAATATGTACAAGCAGCTGGGATACAGTGTCTATCGAACTGTCATAGAGTATTACTCAGCCAGCAATGGGGAGCCGGATGAAGATGCGTACGACATGAGAAAAGCTCTATCAAGAGACACAGAGAAGAAGTCTATCGTACCTCTACCACATCCTGTGAGACCAGAAGACATTGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCATGGCAGCTCTGGCCCGTGTCTCAAAACCCCTCTAAAGGTTCCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAACGCTGAGAGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829362
dbEST ID: 79647064
Trimmed Sequence: TTCAATGTCTTCTGGTCTCACAGGATGTGGTAGAGGTACGATAGACTTCTTCTCTGTGTCTCTTGATAGAGCTTTTCTCATGTCGTACGCATCTTCATCCGGCTCCCCATTGCTGGCTGAGTAATACTCTATGACAGTTCGATAGACACTGTATCCCAGCTGCTTGTACATATTCACTGCAACTTGATTGGAGACTCTTACAAACAAATCAACAAAAAATCCTCCTTTTCTTTCAGAAATTTCTTCTAGTAATTCCATCAGTTTAGCTGCCAGCCCAAGACGTCGGAATTCTGGAGCAACAGACAGAGCAGTGACGTGCCCATGCCATTCCTCTCGTGCTACTGAACCCTCGGCTTTTCCCATTATGTAGCCCATGAGTTCTCCACCTGGTGCCTCTGCAACAATAAAATATTCGGGCCAGTGTGCCAAATACTGCAGGTAAAAAGGAATGCCATAAGTCTCAGTTAGTGGATCCAAGTTGATGTTATTAAATCGAAACAGATCATCACACGTGAAAGCTCTCAGGGTTGTCCTGGGGC
Full Trace Sequence: GCTGCAGGGAGCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCAATGTCTTCTGGTCTCACAGGATGTGGTAGAGGTACGATAGACTTCTTCTCTGTGTCTCTTGATAGAGCTTTTCTCATGTCGTACGCATCTTCATCCGGCTCCCCATTGCTGGCTGAGTAATACTCTATGACAGTTCGATAGACACTGTATCCCAGCTGCTTGTACATATTCACTGCAACTTGATTGGAGACTCTTACAAACAAATCAACAAAAAATCCTCCTTTTCTTTCAGAAATTTCTTCTAGTAATTCCATCAGTTTAGCTGCCAGCCCAAGACGTCGGAATTCTGGAGCAACAGACAGAGCAGTGACGTGCCCATGCCATTCCTCTCGTGCTACTGAACCCTCGGCTTTTCCCATTATGTAGCCCATGAGTTCTCCACCTGGTGCCTCTGCAACAATAAAATATTCGGGCCAGTGTGCCAAATACTGCAGGTAAAAAGGAATGCCATAAGTCTCAGTTAGTGGATCCAAGTTGATGTTATTAAATCGAAACAGATCATCACACGTGAAAGCTCTCAGGGTTGTCCTGGGGCCAACTTTTTTGTACAAAGTTGGGCTTTATGAAAAAAGCATTGCTGCATCATTTGGGTGGCACCGAACAGGGTCACTATCAGTTCAAAATAAAATCTTTAATTAGGGAAAACAAAGTTTAAGACGGGCCCGTCGTTTTACAACAGCCCGCGGAGACTGGGGAAAGTTGGGCGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCAATGTCTTCTGGTCTCAC