ORFeome > naa30 ORF1 – XORFeome v1.0

naa30 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: naa30
Gene ID: 877045
Gene Page ID: 877039
ORF Xenbase ID: 17285523

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123156
Original XGC clone length: 822

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ838172
dbEST ID: 79655874
Trimmed Sequence: ATGGCGGATGCACCGTCAGGCCCGAGCGTTCTCTCTCACTACCCCGGGGCCGGACTCGCTGGAGAACAGCAGCGAGAGGAGGAGAGACACAAGGGCTGCCATCACCACCAGCTCAACGGGCTCATCAGCCCCGACCTGCGGCACCTGAAGGCCGTGTCCTCCCTGAAGAACAAGCTGCTCGAGCAGAAGACCAGGAAGGACTCCGGCCTTGTCCAGCCCCAGGGACGGACTGATACACGGGCTCCCAACGGACTGGAGCGGCTCCAGGGGGAGGAGGAGAAGCTCAGCGCGTGTCTGGCCTCCTGCAGCCTCCGGGGAGATGGGGAAGCGCTCGGCAATCACGTCAGTCAGGGGGAGAACGACGACACGATACGATATGTGCGATACGAGTCCGAGTTACAAATGGCCGACATCATGAGACTCATCACCAGGGATCTGTCCGAACCTTACTCCATTTATACCTATAGATATTTTATTCACAACTGGCCGCAGCTTTGCTTTTTGGCCATGGTAGGCGAAGAGTGCGTAGGTGCCATCGTTTGCAAGTTGGATATGCACAAAAAGATGTTCCGACGAGGTTATATAGCCATGTTAGCTGTGGATTCCAATACAGAAGAAAGGGCATTGGTACACATTTGGTTAAGAAAGCTATTTATGCCATGGGTTGAAGGGATTGGTGATGAGGTTGTATTTGGAACCAAAAATACAAACAAATTCGCCCTTTAACCCGTATGAAACCCTTGGCCTTTGTTCGAAAAAAACCCCCCGTTTCCAAAACATTTTAAATGG
Full Trace Sequence: TCGAGGGCCAAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGATGCACCGTCAGGCCCGAGCGTTCTCTCTCACTACCCCGGGGCCGGACTCGCTGGAGAACAGCAGCGAGAGGAGGAGAGACACAAGGGCTGCCATCACCACCAGCTCAACGGGCTCATCAGCCCCGACCTGCGGCACCTGAAGGCCGTGTCCTCCCTGAAGAACAAGCTGCTCGAGCAGAAGACCAGGAAGGACTCCGGCCTTGTCCAGCCCCAGGGACGGACTGATACACGGGCTCCCAACGGACTGGAGCGGCTCCAGGGGGAGGAGGAGAAGCTCAGCGCGTGTCTGGCCTCCTGCAGCCTCCGGGGAGATGGGGAAGCGCTCGGCAATCACGTCAGTCAGGGGGAGAACGACGACACGATACGATATGTGCGATACGAGTCCGAGTTACAAATGGCCGACATCATGAGACTCATCACCAGGGATCTGTCCGAACCTTACTCCATTTATACCTATAGATATTTTATTCACAACTGGCCGCAGCTTTGCTTTTTGGCCATGGTAGGCGAAGAGTGCGTAGGTGCCATCGTTTGCAAGTTGGATATGCACAAAAAGATGTTCCGACGAGGTTATATAGCCATGTTAGCTGTGGATTCCAATACAGAAGAAAGGGCATTGGTACACATTTGGTTAAGAAAGCTATTTATGCCATGGGTTGAAGGGATTGGTGATGAGGTTGTATTTGGAACCAAAAATACAAACAAATTCGCCCTTTAACCCGTATGAAACCCTTGGCCTTTGTTCGAAAAAAACCCCCCGTTTCCAAAACATTTTAAATGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGATGCACCGTCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838171
dbEST ID: 79655873
Trimmed Sequence: ACGCAGCCATAGTTTAAGACGCAGTGCATCTACTCCATTTAAATAGTATCTGAACAGGCGCTTATCTCGCACAAAGCCAAGGTTTTCATACAGTTTCAAGGCCGACTTGTTTGTAATCTCTGTTTCCAATACAACCTCATCACAATCCCCTTCAACCATGGCATAAATAGCTTTCTTAACCAAATGTGTACCAATGCCCTTTCTTCTGTATTTGGAATCCACAGCTAACATGGCTATATAACCTCGTCGGAACATCTTTTTGTGCATATCCAACTTGCAAACGATGGCACCTACGCACTCTTCGCCTACCATGGCCAAAAAGCAAAGCTGCGGCCAGTTGTGAATAAAATATCTATAGGTATAAATGGAGTAAGGTTCGGACAGATCCCTGGTGATGAGTCTCATGATGTCGGCCATTTGTAACTCGGACTCGTATCGCACATATCGTATCGTGTCGTCGTTCTCCCCCTGACTGACGTGATTGCCCAGCGCTTCCCCATCTCCCCGGAGGCTGCAGGAGGCCAGACACGCGCTGAGCTTCTCCTCCCTCCCCTGGAGCCGCTCCAGTCCGTTGGGAGCCCGTGTATAAGTCCCGTCCCTGGGGGCTGGAACAGGCCGGGAGTCCTTTCCTGGTCTTTCCGCTCGAGCAACCTTGGTCTTCCAGGGAAGACACCGGGCTTCAGGGGGCCGCAAGGTCGGGGGCTAAATTAGCCCCCTTTTAACCTGGTTGTGGATGGGCACCCCCCTTTTTTTCCTCCTCTTCCTTCTCCTCTTGCCTTT
Full Trace Sequence: GGGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACGCAGCCATAGTTTAAGACGCAGTGCATCTACTCCATTTAAATAGTATCTGAACAGGCGCTTATCTCGCACAAAGCCAAGGTTTTCATACAGTTTCAAGGCCGACTTGTTTGTAATCTCTGTTTCCAATACAACCTCATCACAATCCCCTTCAACCATGGCATAAATAGCTTTCTTAACCAAATGTGTACCAATGCCCTTTCTTCTGTATTTGGAATCCACAGCTAACATGGCTATATAACCTCGTCGGAACATCTTTTTGTGCATATCCAACTTGCAAACGATGGCACCTACGCACTCTTCGCCTACCATGGCCAAAAAGCAAAGCTGCGGCCAGTTGTGAATAAAATATCTATAGGTATAAATGGAGTAAGGTTCGGACAGATCCCTGGTGATGAGTCTCATGATGTCGGCCATTTGTAACTCGGACTCGTATCGCACATATCGTATCGTGTCGTCGTTCTCCCCCTGACTGACGTGATTGCCCAGCGCTTCCCCATCTCCCCGGAGGCTGCAGGAGGCCAGACACGCGCTGAGCTTCTCCTCCCTCCCCTGGAGCCGCTCCAGTCCGTTGGGAGCCCGTGTATAAGTCCCGTCCCTGGGGGCTGGAACAGGCCGGGAGTCCTTTCCTGGTCTTTCCGCTCGAGCAACCTTGGTCTTCCAGGGAAGACACCGGGCTTCAGGGGGCCGCAAGGTCGGGGGCTAAATTAGCCCCCTTTTAACCTGGTTGTGGATGGGCACCCCCCTTTTTTTCCTCCTCTTCCTTCTCCTCTTGCCTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGCAGCCATAGTTTAAGACGCA