ORFeome > napg ORF1 – XORFeome v1.0

napg ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: napg
Gene ID: 6254706
Gene Page ID: 967830
ORF Xenbase ID: 17285649

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108810
Original XGC clone length: 945

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: A10

Sequences - 5ʹ (forward) EST

Accession: JZ837655
dbEST ID: 79655357
Trimmed Sequence: ATGGCTGCTCAGAAGATCAATGAGGCGCTGGAGCACCTGGCAAAAGCAGAAAAAAGCTTGAAGACAAGTTTTTTGAAGTGGAAACCTGATTATGACAGCGCAGCCTCTGAATATGCAAAAGCAGCGGTTGCCTTTAAAAATGCCAAGCAATATGATCAAGCAAGAGAAGCCTTTTTAAAAGAAGCTGAATCGTATGAGAACAACAAATCACTTTTCCATGCTGCTAAAGCTTATGAACAAGCAGGGATGATGCTAAAGGAGATGCAAAAACTTCCAGAAGCAGTCCAGCTGATAGAAAAAGCCAGCATGATGTATCTGGAAAATGGAACTCCTGACACAGCTGCTATGGCACTAGAGCGAGCTGGAAAACTAATCGAGCATGTGAATCTGGAAAAGGCAGTGAATCTCTATCAACAATCTGCATCTGTTTTTGAGAATGAAGATCGGTTACGTCAGGCTGTCGAACTTCTTGGAAAGGCATCAAGACTTCTAGTAAGAGCTCGCAGACTAGATGAGGCTGTAGCATCCATTCAGAAGGAAAAAAATATGTATAAAGAAATAGAGAATTATCCAACTTTCTACAAGAAAACTATTGCTCANGTGTTGGTGCATCTTCATAGGAATGACTTTGTTGCTGCTGAGAAATGTGTTAGAGAAAGCTACAGTATACCTGGTTTCATTGGGAGTGAAAACTGCATTGCATTGGAACAACTT
Full Trace Sequence: CGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTCAGAAGATCAATGAGGCGCTGGAGCACCTGGCAAAAGCAGAAAAAAGCTTGAAGACAAGTTTTTTGAAGTGGAAACCTGATTATGACAGCGCAGCCTCTGAATATGCAAAAGCAGCGGTTGCCTTTAAAAATGCCAAGCAATATGATCAAGCAAGAGAAGCCTTTTTAAAAGAAGCTGAATCGTATGAGAACAACAAATCACTTTTCCATGCTGCTAAAGCTTATGAACAAGCAGGGATGATGCTAAAGGAGATGCAAAAACTTCCAGAAGCAGTCCAGCTGATAGAAAAAGCCAGCATGATGTATCTGGAAAATGGAACTCCTGACACAGCTGCTATGGCACTAGAGCGAGCTGGAAAACTAATCGAGCATGTGAATCTGGAAAAGGCAGTGAATCTCTATCAACAATCTGCATCTGTTTTTGAGAATGAAGATCGGTTACGTCAGGCTGTCGAACTTCTTGGAAAGGCATCAAGACTTCTAGTAAGAGCTCGCAGACTAGATGAGGCTGTAGCATCCATTCAGAAGGAAAAAAATATGTATAAAGAAATAGAGAATTATCCAACTTTCTACAAGAAAACTATTGCTCANGTGTTGGTGCATCTTCATAGGAATGACTTTGTTGCTGCTGAGAAATGTGTTAGAGAAAGCTACAGTATACCTGGTTTCATTGGGAGTGAAAACTGCATTGCATTGGAACAACTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTCAGAAGATCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837654
dbEST ID: 79655356
Trimmed Sequence: ACACAAGCCACCTGAATACTCATCATCCTCTTCCTCAGCTCGAGCTCCACCCTGAGCTTGTCCCATTTCTGTGACCGACGTGGGGGCAGGGGACTTCTTTTTGCTTCCGCCACCAGGAACAGCAAGACTCAAAGCAAGTTTTGCATAATCATTATCCATGTATTTAAAAAGAGGAGAGTTGCAAACGTCAGACACTTGGTCCTGGTCCTGTTGATCATATCCTTCCAAAAGCTGTTCCAATGCAATGCAGTCTTCACTCCCACTGAAACCAGGTATACTGTAGCTTTCTCTAACACATTTCTCAGCAGCAACAAAGTCATTCCTATGAAGATGCACCAACACCTGAGCAATAGTTTTCTTGTAGAAAGTTGGATAATTCTCTATTTCTTTATACATATTTTTTTCCTTCTGAATGGATGCTACAGCCTCATCTAGTCTGCGAGCTCTTACTAGAAGTCTTGATGCCTTTCCAAGAAGTTCGACAGCCTGACGTAACCGATCTTCATTCTCAAAAACAGATGCAGATTGTTGATAGAGATTCACTGCCTTTTCCAGATTCACATGCTCGAATAGTTTTCCAGCTCGCTCTAGTGCCAGAGCAGCTGTGTCAGGAGTGCCGTTTTCCAGATAAATCAAGGCGGGCTTTTTCTATCAACTGGACGGCTTCGGGAAGTGGTTGCATCTCCTTTAACAAACACCGCGGCTTGGGCATAAGCCTTAGCAGCAGGGGAAAGGGGAATTGGGGTTCTGCGACAAATCAGCTTCCTTTAAAAAGGCTTCCCTGGCTTGACCAAAAAGCTGGGCGGTTTGAAAGGCGAACGCCGGCTTTGGGAATGGGGAGGGCGGGGGGGGGCGAATGCAGGTTGCGGGGCGAAAAAAGTGTCGGCGAGGGTTGTTTGGGCTTTGGGCGGGGGGGGCGGGCGCGCGCTTGAATATGGAAAGAGGCAAAGGGGCCCAGTGTTTGTGGTAAAGGTTGGGCAGAAAAAAAAAGAATTGGAGCGCCGGTTTTGGGGCGAAAGAAAAAGAGAAAAAAAAAAAAAAGAAAAAAAAAAAAAATAAATAGGGGGGCCCCGAAAAGCAAGAGAAAGGAGCCGTCGTTTTTGAGAGGCCGGGGCCTAGGAGAGGGGGGGGAGAGGGAGGGGGGNGGGAGAAGGCGAGAAAGGGAGAAGGGGGGG
Full Trace Sequence: CTGCCAGGGGAACAGCTTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACACAAGCCACCTGAATACTCATCATCCTCTTCCTCAGCTCGAGCTCCACCCTGAGCTTGTCCCATTTCTGTGACCGACGTGGGGGCAGGGGACTTCTTTTTGCTTCCGCCACCAGGAACAGCAAGACTCAAAGCAAGTTTTGCATAATCATTATCCATGTATTTAAAAAGAGGAGAGTTGCAAACGTCAGACACTTGGTCCTGGTCCTGTTGATCATATCCTTCCAAAAGCTGTTCCAATGCAATGCAGTCTTCACTCCCACTGAAACCAGGTATACTGTAGCTTTCTCTAACACATTTCTCAGCAGCAACAAAGTCATTCCTATGAAGATGCACCAACACCTGAGCAATAGTTTTCTTGTAGAAAGTTGGATAATTCTCTATTTCTTTATACATATTTTTTTCCTTCTGAATGGATGCTACAGCCTCATCTAGTCTGCGAGCTCTTACTAGAAGTCTTGATGCCTTTCCAAGAAGTTCGACAGCCTGACGTAACCGATCTTCATTCTCAAAAACAGATGCAGATTGTTGATAGAGATTCACTGCCTTTTCCAGATTCACATGCTCGAATAGTTTTCCAGCTCGCTCTAGTGCCAGAGCAGCTGTGTCAGGAGTGCCGTTTTCCAGATAAATCAAGGCGGGCTTTTTCTATCAACTGGACGGCTTCGGGAAGTGGTTGCATCTCCTTTAACAAACACCGCGGCTTGGGCATAAGCCTTAGCAGCAGGGGAAAGGGGAATTGGGGTTCTGCGACAAATCAGCTTCCTTTAAAAAGGCTTCCCTGGCTTGACCAAAAAGCTGGGCGGTTTGAAAGGCGAACGCCGGCTTTGGGAATGGGGAGGGCGGGGGGGGGCGAATGCAGGTTGCGGGGCGAAAAAAGTGTCGGCGAGGGTTGTTTGGGCTTTGGGCGGGGGGGGCGGGCGCGCGCTTGAATATGGAAAGAGGCAAAGGGGCCCAGTGTTTGTGGTAAAGGTTGGGCAGAAAAAAAAAGAATTGGAGCGCCGGTTTTGGGGCGAAAGAAAAAGAGAAAAAAAAAAAAAAGAAAAAAAAAAAAAATAAATAGGGGGGCCCCGAAAAGCAAGAGAAAGGAGCCGTCGTTTTTGAGAGGCCGGGGCCTAGGAGAGGGGGGGGAGAGGGAGGGGGGNGGGAGAAGGCGAGAAAGGGAGAAGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACACAAGCCACCTGAATAC