ORFeome > nbr1 ORF1 – XORFeome v1.0

nbr1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nbr1
Gene ID: 949696
Gene Page ID: 949691
ORF Xenbase ID: 17285691

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC057740
Original XGC clone length: 2910

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11019
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ824602
dbEST ID: 79642304
Trimmed Sequence: ATGGAGTCCCAGGTGAATTTGTGTGTGAGCTGTAATGGAGAATCCCAAAACTTTCTAGTGTCTGACTCTGAAAATACAACTTGGGCTGACGTGGAGACAATGGTGCTTGTCTCTTATGATCTGAATGACATCCAGATAAAGTACATGGATGAGGATAATGAAGAGGTGTCTGTGAACAGCCAAGGGGAAAATGAAGAAGCTTTAAAGAGTGCAGTGAAGCAGGGAGGACTTCTTCGAATGAATGTGTATGAAAAGCAACAGCCTAGCAAGAGTGAAGAGCCTGCAAACTTTGCAGAATTGAAACCACTGGAGCCCAAAAACTCTTCTGCTGTCACAATTGGAAAGAGACCACTGGGGAATTATTCCTTGTTGGCAAGGACAATGGGGCAAGACATTCAGATGGCACAAGCTTCCAGTAATGCAACGAGTGCAGTGAATCAAGGAGGACTTCTGCAAATGAATGTCTATGGCAAGCAACAGCTTAGCAAGAGTGAAGAGCCTGCAGGCCGTGAAGAACTTAATAAACCCCTGGAGTCAAAAATCTCCGCTGCTGTCACAAATGGAAAGAGTCCACTGGAGCATTATTCTATTCTTGCAAGGACTTTGGGACAAGAAATGCAGAGGGCAAGAACTTCTAGTAGTGCAGAGGAGCAGCTTGCACCAACTGAGACCAAGGAATCAACTGTAATCCCACCAGACTGGTTTTGCAGTTATATGGAAAAAATTAGGGAACAATCATACTTGAAACAGTGGGAAAGGGTGACCCAGTCTCTAGAAAAGAACTCCATATCCGACTCCGGGCAGCTACTCCATTCAAAAAAAAAAAAATCCAGG
Full Trace Sequence: ATTTTTATTTTTCGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGTCCCAGGTGAATTTGTGTGTGAGCTGTAATGGAGAATCCCAAAACTTTCTAGTGTCTGACTCTGAAAATACAACTTGGGCTGACGTGGAGACAATGGTGCTTGTCTCTTATGATCTGAATGACATCCAGATAAAGTACATGGATGAGGATAATGAAGAGGTGTCTGTGAACAGCCAAGGGGAAAATGAAGAAGCTTTAAAGAGTGCAGTGAAGCAGGGAGGACTTCTTCGAATGAATGTGTATGAAAAGCAACAGCCTAGCAAGAGTGAAGAGCCTGCAAACTTTGCAGAATTGAAACCACTGGAGCCCAAAAACTCTTCTGCTGTCACAATTGGAAAGAGACCACTGGGGAATTATTCCTTGTTGGCAAGGACAATGGGGCAAGACATTCAGATGGCACAAGCTTCCAGTAATGCAACGAGTGCAGTGAATCAAGGAGGACTTCTGCAAATGAATGTCTATGGCAAGCAACAGCTTAGCAAGAGTGAAGAGCCTGCAGGCCGTGAAGAACTTAATAAACCCCTGGAGTCAAAAATCTCCGCTGCTGTCACAAATGGAAAGAGTCCACTGGAGCATTATTCTATTCTTGCAAGGACTTTGGGACAAGAAATGCAGAGGGCAAGAACTTCTAGTAGTGCAGAGGAGCAGCTTGCACCAACTGAGACCAAGGAATCAACTGTAATCCCACCAGACTGGTTTTGCAGTTATATGGAAAAAATTAGGGAACAATCATACTTGAAACAGTGGGAAAGGGTGACCCAGTCTCTAGAAAAGAACTCCATATCCGACTCCGGGCAGCTACTCCATTCAAAAAAAAAAAAATCCAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTCCCAGGTGAATTTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829952
dbEST ID: 79647654
Trimmed Sequence: GTAACGAGCAGAGTACCAGTCGTTGTCATTGATCTGGATCAGCTCAGTCACTACGTCCATGAGGTTGCCGTCATGTTTGCGTAGCAGGCGTTGGTTGAGCTGCCGGTCACAGAATCCCATCTCGAAGAGAATAGCCATCATTGCTCTTTCTTGTTCTTCTGAATTTCTTGGCAGATTTGTCTCCTGTTGACCGGAGAATAAAGCCTTATAAGCAGACGCAGCAACCGACAGAGCTCCTTTTACAAGACCCCCGGCAATGCTGACAGCTCTTGGATGTTCAGTCTGTTCATTGGGTGCTGGGGTGAAAGCGGTAGTTTCTAACGCTGGTGCATTTTCATCTGAAGAATCTTGGTTTTTTTGCTCTGGAAAGGATTGCCTGATGGTTGTAGGTTCAGCTTCTGTTGTCAGAGATAAAGCAGCTCCTGGAGCCTCATGCAATGCCCTTGTTTGGGGTGATGGTCTCATCACTTCTGGTGTAAGTGGGACAGTATCTAAGGTTTGTGATATAGTGAAAATGTCATTGATGCTGTGACACGGGGACTGCTGACCATTGTCTTCATCTTCTTTTGCCCCTGTCTTTATTTCCGTGTCACATCCTGTCTCAGAAAGAGCTGAATTGTACATGGACTCTTCCNATGGGGCGAGATGTGTCAAANCACTCAGGAGGGAATAATGATGTAGTCCNTCTGTANGAATCCCATGATTCCCTGGGTTCCCCGTGTTTCATCGTTTGTATTCTTTCCCTTCCATGTTTTTGTTCATAATAAATTCAAAAAGGGA
Full Trace Sequence: CGGGAAAACTGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAACGAGCAGAGTACCAGTCGTTGTCATTGATCTGGATCAGCTCAGTCACTACGTCCATGAGGTTGCCGTCATGTTTGCGTAGCAGGCGTTGGTTGAGCTGCCGGTCACAGAATCCCATCTCGAAGAGAATAGCCATCATTGCTCTTTCTTGTTCTTCTGAATTTCTTGGCAGATTTGTCTCCTGTTGACCGGAGAATAAAGCCTTATAAGCAGACGCAGCAACCGACAGAGCTCCTTTTACAAGACCCCCGGCAATGCTGACAGCTCTTGGATGTTCAGTCTGTTCATTGGGTGCTGGGGTGAAAGCGGTAGTTTCTAACGCTGGTGCATTTTCATCTGAAGAATCTTGGTTTTTTTGCTCTGGAAAGGATTGCCTGATGGTTGTAGGTTCAGCTTCTGTTGTCAGAGATAAAGCAGCTCCTGGAGCCTCATGCAATGCCCTTGTTTGGGGTGATGGTCTCATCACTTCTGGTGTAAGTGGGACAGTATCTAAGGTTTGTGATATAGTGAAAATGTCATTGATGCTGTGACACGGGGACTGCTGACCATTGTCTTCATCTTCTTTTGCCCCTGTCTTTATTTCCGTGTCACATCCTGTCTCAGAAAGAGCTGAATTGTACATGGACTCTTCCNATGGGGCGAGATGTGTCAAANCACTCAGGAGGGAATAATGATGTAGTCCNTCTGTANGAATCCCATGATTCCCTGGGTTCCCCGTGTTTCATCGTTTGTATTCTTTCCCTTCCATGTTTTTGTTCATAATAAATTCAAAAAGGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAACGAGCAGAGTACCA