ORFeome > ncald ORF1 – XORFeome v1.0

ncald ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ncald
Gene ID: 6078000
Gene Page ID: 948386
ORF Xenbase ID: 17285697

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054982
Original XGC clone length: 582

Human orthology & disease relationships

NCBI Entrez ID: 83988
Ensembl gene IDs: ENSG00000104490
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 124900,125800,161800,301000,313900,600652,603278,603622,605249,608751

Library Location

Plate ID: GDExl11002
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ839361
dbEST ID: 79657063
Trimmed Sequence: ATGGGGAAGCAGAACAGCAAGTTGCGCCCTGAGGTCATGCAGGACTTACTAGAAAGCACAGACTTTACTGAGCACGAGATCCAGGAGTGGTACAAGGGATTCTTGAGAGACTGTCCAAGCGGGAACTTAACCATGGAGGAGTTTAAGAAAATATATGGGAACTTTTTTCCTTACGGGGACGCTTCTAAGTTTGCAGAACATGTATTCCGCACGTTTGATGCCAACGGGGACGGGACAATTGATTTTAGAGAATTTATTATCGCTCTGAGTGTAACTTCCAGGGGGAAACTGGAACAGAAGTTGAAGTGGGCATTTAGCATGTACGACTTGGATGGGAATGGGTACATCAGCAAAGCAGAAATGCTGGAAATCGTGCAGGCAATCTATAAGATGGTTTCTTCAGTAATGAAAATGCCAGAGGATGAGTCAACACCAGAGAAAAGGACAGAGAAAATATTTCGGCAAATGGATACCAACCGAGACGGAAAACTCTCATTGGAAGAATTCATCAGAGGGGCAAAAAGTGACCCATCCATCGTGCGCCTCCTTCAGTGTGATCCGAGCAGTGCTGGACGGTTCTT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGAAGCAGAACAGCAAGTTGCGCCCTGAGGTCATGCAGGACTTACTAGAAAGCACAGACTTTACTGAGCACGAGATCCAGGAGTGGTACAAGGGATTCTTGAGAGACTGTCCAAGCGGGAACTTAACCATGGAGGAGTTTAAGAAAATATATGGGAACTTTTTTCCTTACGGGGACGCTTCTAAGTTTGCAGAACATGTATTCCGCACGTTTGATGCCAACGGGGACGGGACAATTGATTTTAGAGAATTTATTATCGCTCTGAGTGTAACTTCCAGGGGGAAACTGGAACAGAAGTTGAAGTGGGCATTTAGCATGTACGACTTGGATGGGAATGGGTACATCAGCAAAGCAGAAATGCTGGAAATCGTGCAGGCAATCTATAAGATGGTTTCTTCAGTAATGAAAATGCCAGAGGATGAGTCAACACCAGAGAAAAGGACAGAGAAAATATTTCGGCAAATGGATACCAACCGAGACGGAAAACTCTCATTGGAAGAATTCATCAGAGGGGCAAAAAGTGACCCATCCATCGTGCGCCTCCTTCAGTGTGATCCGAGCAGTGCTGGACGGTTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATTAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAATCATTAATTTGCCTCCACCTGATATCCCCCATAGTGGATCCTAATACATGGGAAAAAAAAAAAAAACAAGGAAGCTTCTGGCCCCGGGTCCCAAACAACCACAAAAAGTGTAAAAAAATGACAAGAAAAGTTTCGGCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAAGCAGAACAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839360
dbEST ID: 79657062
Trimmed Sequence: GAACCGTCCAGCACTGCTCGGATCACACTGAAGGAGGCGCACGATGGATGGGTCACTTTTTGCCCCTCTGATGAATTCTTCCAATGAGAGTTTTCCGTCTCGGTTGGTATCCATTTGCCGAAATATTTTCTCTGTCCTTTTCTCTGGTGTTGACTCATCCTCTGGCATTTTCATTACTGAAGAAACCATCTTATAGATTGCCTGCACGATTTCCAGCATTTCTGCTTTGCTGATGTACCCATTCCCATCCAAGTCGTACATGCTAAATGCCCACTTCAACTTCTGTTCCAGTTTCCCCCTGGAAGTTACACTCAGAGCGATAATAAATTCTCTAAAATCAATTGTCCCGTCCCCGTTGGCATCAAACGTGCGGAATACATGTTCTGCAAACTTAGAAGCGTCCCCGTAAGGAAAAAAGTTCCCATATATTTTCTTAAACTCCTCCATGGTTAAGTTCCCGCTTGGACAGTCTCTCAAGAATCCCTTGTACCACTCCTGGATCTCGTGCTCAGTAAAGTCTGTGCTTTCTAGTAAGTCCTGCATGACCTCAGGGCGCAACTTGCTGTTCTGCTTCCCCATGGTGCCCCAC
Full Trace Sequence: GAGGAATCAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAACCGTCCAGCACTGCTCGGATCACACTGAAGGAGGCGCACGATGGATGGGTCACTTTTTGCCCCTCTGATGAATTCTTCCAATGAGAGTTTTCCGTCTCGGTTGGTATCCATTTGCCGAAATATTTTCTCTGTCCTTTTCTCTGGTGTTGACTCATCCTCTGGCATTTTCATTACTGAAGAAACCATCTTATAGATTGCCTGCACGATTTCCAGCATTTCTGCTTTGCTGATGTACCCATTCCCATCCAAGTCGTACATGCTAAATGCCCACTTCAACTTCTGTTCCAGTTTCCCCCTGGAAGTTACACTCAGAGCGATAATAAATTCTCTAAAATCAATTGTCCCGTCCCCGTTGGCATCAAACGTGCGGAATACATGTTCTGCAAACTTAGAAGCGTCCCCGTAAGGAAAAAAGTTCCCATATATTTTCTTAAACTCCTCCATGGTTAAGTTCCCGCTTGGACAGTCTCTCAAGAATCCCTTGTACCACTCCTGGATCTCGTGCTCAGTAAAGTCTGTGCTTTCTAGTAAGTCCTGCATGACCTCAGGGCGCAACTTGCTGTTCTGCTTCCCCATGGTGCCCCACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTTGCTCCATCATTTTGTTGCAACGAACAAGGTCACTATCAAGTCAAAATTAAAATCAAATATTTGGGGGCCCGAAGCTTAATAACGGGCCGTCGTTTCAGCTCAATCCATTTAATACATGGGGGGGTTTTTCCCCGGGGCGACTCTCTGGGCCCCGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAACCGTCCAGCACTGCTC