ORFeome > ndfip1 ORF2 – XORFeome v1.0

ndfip1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256685
Gene Page ID:
ORF Xenbase ID: 17285847

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128974
Original XGC clone length: 636

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: G07

Sequences - 5ʹ (forward) EST

Accession: JZ838514
dbEST ID: 79656216
Trimmed Sequence: ATGTCCGAGCAGAACAGCAGTAGATATCAGCAGTTACAAAATGAAGAAGATCCTGAAGAAAATCCTCAGGGTGCCACAGATGCCCCACCACCATACAGCAGTATCGCTGGTGAAAGTTCAGGACTTTTTGATTACAAGGACGAGTTAGGATTTCCAAAACCACCTTCTTACAATGTGGCAACAACACTGCCCAGTTATGATGAAGCAGAGAGGACCAAAGCAGAGGCTACCATCCCTCTTGTCTCTGGCAGGGATGACGATTTTGTGGCAAGGGATGATTTTGATGATGCAAATCAGCTGCGGATAGGAAACGATGGGATTTTCATGCTTACTTTCTTCATGGCATTCCTGTTTAACTGGATTGGGTTTTTCCTTTCTTTCTGCCTAACCTCATCTGCAGCAGGCAGATATGGAGCTATTTCTGGTTTTGGCCTCTCTCTAATTAAGTGGAGTCTAATTGTACGGTTCTCCACCTATTTCCCTGGATATTTTGATGGCCAGTACTGGGTTTGGGGGGGGTCTTTGTACTCGGATTCCTTTTTTTTCTCGTAGGCTGTTGGCGGTATGCAGGGGTTGGAAGGGTGCAGGAAGGGTTTTGTCCCTCTCCCCCCCTACCGGGGGTTGCTGGATTAGTTTGCAGTTTTTCTTTGAATATGTTGGGGGTTAGGGAAGAAATTGATTATATATTTGGGTTGACAGGTAAGCGGGACCAAAGAGGCCGCAAATAAAATAAAAAAATAGGATGACGCGGCGGGGTCGAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAGCAAAAAGAGTAGAAAACA
Full Trace Sequence: TCGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCGAGCAGAACAGCAGTAGATATCAGCAGTTACAAAATGAAGAAGATCCTGAAGAAAATCCTCAGGGTGCCACAGATGCCCCACCACCATACAGCAGTATCGCTGGTGAAAGTTCAGGACTTTTTGATTACAAGGACGAGTTAGGATTTCCAAAACCACCTTCTTACAATGTGGCAACAACACTGCCCAGTTATGATGAAGCAGAGAGGACCAAAGCAGAGGCTACCATCCCTCTTGTCTCTGGCAGGGATGACGATTTTGTGGCAAGGGATGATTTTGATGATGCAAATCAGCTGCGGATAGGAAACGATGGGATTTTCATGCTTACTTTCTTCATGGCATTCCTGTTTAACTGGATTGGGTTTTTCCTTTCTTTCTGCCTAACCTCATCTGCAGCAGGCAGATATGGAGCTATTTCTGGTTTTGGCCTCTCTCTAATTAAGTGGAGTCTAATTGTACGGTTCTCCACCTATTTCCCTGGATATTTTGATGGCCAGTACTGGGTTTGGGGGGGGTCTTTGTACTCGGATTCCTTTTTTTTCTCGTAGGCTGTTGGCGGTATGCAGGGGTTGGAAGGGTGCAGGAAGGGTTTTGTCCCTCTCCCCCCCTACCGGGGGTTGCTGGATTAGTTTGCAGTTTTTCTTTGAATATGTTGGGGGTTAGGGAAGAAATTGATTATATATTTGGGTTGACAGGTAAGCGGGACCAAAGAGGCCGCAAATAAAATAAAAAAATAGGATGACGCGGCGGGGTCGAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAGCAAAAAGAGTAGAAAACA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGAGCAGAACAGCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838513
dbEST ID: 79656215
Trimmed Sequence: ATAAATAAAGAGAACTCTGGTCCGGGGGAGAGTGGAAAAGTTATCAGGCATCTTTCGAACCTTTGCATAATTGATAAAGCCTCTGAGAAAAAGAAGGAATCCGAGTACAAGGAACACCCACCAAAGCCAGTACTGGCCATCAAAATATCCAGGGAAATAGGTGGAGAACCGTACAATTAGAATCCACTTAATTAGAGAGAGGCCAAAACCAGAAATAGCTCCATATCTGCCTGCTGCAGATGAGGTTAGGCAGAAAGAAAGGAAAAACCCAATCCAGTTAAACAGGAATGCCATGAAGAAAGTAAGCATGAAAATCCCATCGTTTCCTATCCGCAGCTGATCTGCATCATCAAAATCATCCCTTGCCACAAAATCGTCATCCCTGCCAGAGACAAGAGGGATGGTAGCCTCTGCTTTGGTCCTCTCTGCTTCATCATAACTGGGCAGTGTTGTTGCCACATTGTAAGAAGGTGGTTTTGGAAATCCTAACTCGTCCTTGTAATCAAAAAGTCCTGAACTTTCACCACCCATACTGCTGAATGGGTGGTGGGGCATCTGTGGCACCCTGAAGAAATTCCTTTCAGGAGTCGTCTGCTTTTGTAAGTGGCTGATATCGAGCGGCTGGTTCGGGGTCGGAAATGGTGGCCCAACTTTATTGTAAAAGAGTTTGGCATTAATGAGAGAAGGCATTTGGTCTATCAATTTTTGTTAGAAAAAAAAAAAAAGAAAAAAAAAAAGAGAAAAAAAAAAAAAAAAAAAAAATAAATATAAAG
Full Trace Sequence: GGCAATCGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAAATAAAGAGAACTCTGGTCCGGGGGAGAGTGGAAAAGTTATCAGGCATCTTTCGAACCTTTGCATAATTGATAAAGCCTCTGAGAAAAAGAAGGAATCCGAGTACAAGGAACACCCACCAAAGCCAGTACTGGCCATCAAAATATCCAGGGAAATAGGTGGAGAACCGTACAATTAGAATCCACTTAATTAGAGAGAGGCCAAAACCAGAAATAGCTCCATATCTGCCTGCTGCAGATGAGGTTAGGCAGAAAGAAAGGAAAAACCCAATCCAGTTAAACAGGAATGCCATGAAGAAAGTAAGCATGAAAATCCCATCGTTTCCTATCCGCAGCTGATCTGCATCATCAAAATCATCCCTTGCCACAAAATCGTCATCCCTGCCAGAGACAAGAGGGATGGTAGCCTCTGCTTTGGTCCTCTCTGCTTCATCATAACTGGGCAGTGTTGTTGCCACATTGTAAGAAGGTGGTTTTGGAAATCCTAACTCGTCCTTGTAATCAAAAAGTCCTGAACTTTCACCACCCATACTGCTGAATGGGTGGTGGGGCATCTGTGGCACCCTGAAGAAATTCCTTTCAGGAGTCGTCTGCTTTTGTAAGTGGCTGATATCGAGCGGCTGGTTCGGGGTCGGAAATGGTGGCCCAACTTTATTGTAAAAGAGTTTGGCATTAATGAGAGAAGGCATTTGGTCTATCAATTTTTGTTAGAAAAAAAAAAAAAGAAAAAAAAAAAGAGAAAAAAAAAAAAAAAAAAAAAATAAATATAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAAATAAAGAGAACTCTGGTCCG