ORFeome > ndufa10 ORF1 – XORFeome v1.0

ndufa10 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ndufa10
Gene ID: 6254304
Gene Page ID: 949135
ORF Xenbase ID: 17285907

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084366
Original XGC clone length: 1056

Human orthology & disease relationships

NCBI Entrez ID: 4705
Ensembl gene IDs: ENSG00000130414
Directly associated (OMIM) disease MIM numbers: 256000
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: JZ840071
dbEST ID: 79657773
Trimmed Sequence: ATGTTTTCAAGTGCAGCGTCCCGAGGCCTGAGGCTCACAGGCAAAATATGCTCCGGAAGAGTGGCCCAGATTCATGTCAGCTCCAGGCACAGCCTGCTCTATGGCTACTGGGCATATGTACTGGGAGAAAGAACCACCAACCGATTCGGGCCAAACAGCAAGATTATTACAGTTGATGGAAACTTGGCATCTGGCAAGGGACAAATAGCAAAGAAACTGGCAGACAGACTTGGTATGCGATACTTTCCTGAAGCAGATGAACATTACTTAGACAAAACAACTGGAGATGGAAGCATCCTGCCGTCAAAGTTTAGTGGAAATTGCAGCCTGGACAAATTTTATGATGACCCGAAATGTCCTGATGGAAACTCATATCGTTTGCAGTCCTGGATGTATAGTGTGCGCCTCATGCAGTATTCCGATGCTTTGGAGCATCTTCTGAGTACAGGGCAGGGAGCAGTACTGGAACGTTCTCCATTCAGTGACTTTGTGTTCCTGGAAGCAATGTATAAGAATGGATACATCCGCAAGCAGTGTATTGATCATTACAATGAAATCAAAGGTAACAGTATTGATGAGTTTTTGCCTCCTCACCTGGGTATCTATGTGGATGTTCCTGCTGCTGAAATGCACAAGAAAATCTTGGAGAAAGGACATACCTTCTAAAAAAAAATTTGCCTTGCCAACCTTTCAAAATAATGAAAACACCCTATAAAAAAATCTTTCCCTTTCCCAAA
Full Trace Sequence: TTCGAGGCCCATATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTTCAAGTGCAGCGTCCCGAGGCCTGAGGCTCACAGGCAAAATATGCTCCGGAAGAGTGGCCCAGATTCATGTCAGCTCCAGGCACAGCCTGCTCTATGGCTACTGGGCATATGTACTGGGAGAAAGAACCACCAACCGATTCGGGCCAAACAGCAAGATTATTACAGTTGATGGAAACTTGGCATCTGGCAAGGGACAAATAGCAAAGAAACTGGCAGACAGACTTGGTATGCGATACTTTCCTGAAGCAGATGAACATTACTTAGACAAAACAACTGGAGATGGAAGCATCCTGCCGTCAAAGTTTAGTGGAAATTGCAGCCTGGACAAATTTTATGATGACCCGAAATGTCCTGATGGAAACTCATATCGTTTGCAGTCCTGGATGTATAGTGTGCGCCTCATGCAGTATTCCGATGCTTTGGAGCATCTTCTGAGTACAGGGCAGGGAGCAGTACTGGAACGTTCTCCATTCAGTGACTTTGTGTTCCTGGAAGCAATGTATAAGAATGGATACATCCGCAAGCAGTGTATTGATCATTACAATGAAATCAAAGGTAACAGTATTGATGAGTTTTTGCCTCCTCACCTGGGTATCTATGTGGATGTTCCTGCTGCTGAAATGCACAAGAAAATCTTGGAGAAAGGACATACCTTCTAAAAAAAAATTTGCCTTGCCAACCTTTCAAAATAATGAAAACACCCTATAAAAAAATCTTTCCCTTTCCCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTTCAAGTGCAGCGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ840070
dbEST ID: 79657772
Trimmed Sequence: CTTTAGCCAGATCATTTTGTCCCCAATATCTGCATTGTAGCCCTTTGTATATTTTCTTCCAGGTAGCGATCGGTACTGATAGTAGGCTGAATCATACTCTGATGCACCGATTGTGATTTCTGGGATGTAACTAGGCACAGTTATCAGACTGGCAACTTTGTCTTTGTCCTCCACAAACATGCGCAGATGATGATAGGTGACGTCATTCTGTTCTGTCCATGGGCTCTTGTCAAACTTCAGGTATTCAATGTCTTCAACTACCTTCTCTACATCCTGCGCCTCATTCCCAGTGTACTTCAGAATCTCAGAATTCTCACTTATCTGTGGAAGGAAAGATTCTTTATAGGTGTTTTCAATACTCTGAAGGTATGGCAAGGCAACTTTTTTTTCAGAAGTATGTCCTCTCTCCAAGATTTTCTTGTGCACTTCAGCAGCAGGAACATCCACATAGATAACCAGGTGAGGAGGCAAAAACTCATCAATACTGTTACCTTTGATTTCATTGTAATGATCAATACACTGNCTTGCGGATGTATCCATTCTTATACATTGCTTCCAGGAACACAAAGTCACTGAATGGAGAACGTTCCAGTACTGCTCCCTGCCCGGTACTCAGAAAATGCTCCAAAGCATCGGATTACTGCATGAGG
Full Trace Sequence: AAAAAGCCTATAGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTAGCCAGATCATTTTGTCCCCAATATCTGCATTGTAGCCCTTTGTATATTTTCTTCCAGGTAGCGATCGGTACTGATAGTAGGCTGAATCATACTCTGATGCACCGATTGTGATTTCTGGGATGTAACTAGGCACAGTTATCAGACTGGCAACTTTGTCTTTGTCCTCCACAAACATGCGCAGATGATGATAGGTGACGTCATTCTGTTCTGTCCATGGGCTCTTGTCAAACTTCAGGTATTCAATGTCTTCAACTACCTTCTCTACATCCTGCGCCTCATTCCCAGTGTACTTCAGAATCTCAGAATTCTCACTTATCTGTGGAAGGAAAGATTCTTTATAGGTGTTTTCAATACTCTGAAGGTATGGCAAGGCAACTTTTTTTTCAGAAGTATGTCCTCTCTCCAAGATTTTCTTGTGCACTTCAGCAGCAGGAACATCCACATAGATAACCAGGTGAGGAGGCAAAAACTCATCAATACTGTTACCTTTGATTTCATTGTAATGATCAATACACTGNCTTGCGGATGTATCCATTCTTATACATTGCTTCCAGGAACACAAAGTCACTGAATGGAGAACGTTCCAGTACTGCTCCCTGCCCGGTACTCAGAAAATGCTCCAAAGCATCGGATTACTGCATGAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTAGCCAGATCATTTTGTCC