ORFeome > ndufa3 ORF1 – XORFeome v1.0

ndufa3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ndufa3
Gene ID: 6254329
Gene Page ID: 1006322
ORF Xenbase ID: 17285925

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078590
Original XGC clone length: 261

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ839691
dbEST ID: 79657393
Trimmed Sequence: ATGGCAGCCTTCGGTAAAGTAGGCACTTTCCTTAAAAACGCCTGGGCGAAAGAGCCAGTTATAACGGTTTCGGCAGCCATTGGAATTTTGGCTGTGGCCGTTCCGCTTGTAAGTCCCTACACAAAGTATACTGCATTGTTGAATCAATCCACGCCTTACAATTACCCAGTTCCAGTTCGAGATGATGGAAACATGCCAGATGTCCCCGGTCGTCCCACTGAAAAACTTGGGCCTAACTTGGATTGGTTTAAGAACATGTT
Full Trace Sequence: CTTCGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCCTTCGGTAAAGTAGGCACTTTCCTTAAAAACGCCTGGGCGAAAGAGCCAGTTATAACGGTTTCGGCAGCCATTGGAATTTTGGCTGTGGCCGTTCCGCTTGTAAGTCCCTACACAAAGTATACTGCATTGTTGAATCAATCCACGCCTTACAATTACCCAGTTCCAGTTCGAGATGATGGAAACATGCCAGATGTCCCCGGTCGTCCCACTGAAAAACTTGGGCCTAACTTGGATTGGTTTAAGAACATGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCAAAAATCAAAATCTAAGATGTTACAAAAAAACTCCCCTGGCAAAAAACAAAAAAAAAAAAAAATTTCCGGAAACACGGGTTCCGGGTTTTCGGGCTTGTGTAGGGGCAAAATTCCCGACTAACAAAACTACACGGGGGGGTCTAAACTGGGAAAAAAAAACAGGGGGGCACCCCCAGGGTCCAAACCCTATTTACCCTCGTGGGGTGGAGGGAGGGGGGGTTTTTTCTTTTTATAAAGATTTTTATATAATAATTAACCACCCCCCCCGATGTAAACCACCCCGTACCGGGGGGTTTTTTGGGTTTTTAAATAATACTATTTTTCTTGGGGAAACCACCCAACAACCCCCCCCAAACAAAACCAAAAAAAAAGAAACCCGGCAAATAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCCTTCGGTAAAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839690
dbEST ID: 79657392
Trimmed Sequence: CATGTTCTTAAACCAATCCAAGTTAGGCCCAAGTTTTTCAGTGGGACGACCGGGGACATCTGGCATGTTTCCATCATCTCGAACTGGAACTGGGTAATTGTAAGGCGTGGATTGATTCAACAATGCAGTATACTTTGTGTAGGGACTTACAAGCGGAACGGCCACAGCCAAAATTCCAATGGCTGCCGAAACCGTTATAACTGGCTCTTTCGCCCAGGCGTTTTTAAGGAAAGTGCCTACTTTACCGAAGGCTGCCATGG
Full Trace Sequence: GAACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGTTCTTAAACCAATCCAAGTTAGGCCCAAGTTTTTCAGTGGGACGACCGGGGACATCTGGCATGTTTCCATCATCTCGAACTGGAACTGGGTAATTGTAAGGCGTGGATTGATTCAACAATGCAGTATACTTTGTGTAGGGACTTACAAGCGGAACGGCCACAGCCAAAATTCCAATGGCTGCCGAAACCGTTATAACTGGCTCTTTCGCCCAGGCGTTTTTAAGGAAAGTGCCTACTTTACCGAAGGCTGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCAACCTTAATACTGGCCAACGTTTCACAACAAAGTGACAGAGCAGACTCCCATACAGCCAGAAAAAAAAAAAAGCAAAAAAAAACCGGCAAAATGGGGCTGCCGGTTGACCAGTCGGTGGAAAGGAAAAAAGCCCAAAAACAAAGGAAACACCCTGGTTGGATTCGAACTTTTAAGAAATAGCCGGGAGGCGCAACAAAGTGGAAAAAAACCTGGGCGAAGCGAATATGGGAAAGGGCCAAAGGGCGTTTTACGGGTGGTGGTGAAGGTTTTTTAGGGGTGAACCTCAGGCGCGAGGGCGAAAACCAACAAAACGGTCTCCCGGGGGGTCTTAGGGGTAGTGTGTGTAAGGGCGCTCAATCTTATTCCACACCGGAGGGGACCCCCCCNAAAGAGANGAAAAAATTAAAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGTTCTTAAACCAATCCAAGTT