ORFeome > ndufa9 ORF1 – XORFeome v1.0

ndufa9 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ndufa9
Gene ID: 949556
Gene Page ID: 949550
ORF Xenbase ID: 17285955

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054183
Original XGC clone length: 1134

Human orthology & disease relationships

NCBI Entrez ID: 4704
Ensembl gene IDs: ENSG00000139180
Directly associated (OMIM) disease MIM numbers: 256000
Indirectly associated (Lage, et al.) disease MIM numbers: 278750

Library Location

Plate ID: GDExl11001
Well Location: H08

Sequences - 5ʹ (forward) EST

Accession: JZ839074
dbEST ID: 79656776
Trimmed Sequence: ATGGCTGCTGTTACCTTCTGCTCGGTGACCGGAGCCCGAGCAATGTCACGTCCCCAGGTCAAATCCATGGTGACATGTCTTCCCATTGTCCTGCAGCAGAGGAAAGTCCACCATGCTGTTATTCCACACGGGAAACCTGGTCGCTCTGCTAACAGTGGAGTCGTCGCTACAGTTTTCGGCGCAACAGGCTTTCTTGGCCGATATCTTGTCAACAGACTGGGGCGCGTTGGTTCTCAGGTTGTTATACCCTATCGTTGTGAGCCTTATGACATCATGTACCTTAGGCCAATGGGAGATCTGGGACAGTTAATATTCATGGACTGGAATGCAAAGGACAAAGACACCATTAGAAAAGCCCTGGAAAACTCCAACGTTGTCATTAACCTAATCGGAAAAGAGTGGGAAACAAAGAATTTTAGTTATGAAGATGTTTTTGTGAATATTCCGAGAGATCTTGCACTGCTAGCACGGGAGGCTGGAGTAGAGAAATTCATCCACATGTCCCATCTTAACGCTGACCTGAAAAGCCCATCAAAGTATCTGAGGAATAAGGCTGTTGGAGAGGCCGCTGTAAGGGAGGCTTTCCCAGACGCAATCATCATGAAGCCTTCAGAAATGTACGGCAGGGAAGACAGATTCTTCAACCATTATGCAAACATGCGATGNTTTTGGTGGAGTGCCTCTCATTGCCCTTTGGGAAGGAAAACTGTTAAACAACCCAAGTTAATTTTGGTCGATGTTGGCCCAA
Full Trace Sequence: TCGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGTTACCTTCTGCTCGGTGACCGGAGCCCGAGCAATGTCACGTCCCCAGGTCAAATCCATGGTGACATGTCTTCCCATTGTCCTGCAGCAGAGGAAAGTCCACCATGCTGTTATTCCACACGGGAAACCTGGTCGCTCTGCTAACAGTGGAGTCGTCGCTACAGTTTTCGGCGCAACAGGCTTTCTTGGCCGATATCTTGTCAACAGACTGGGGCGCGTTGGTTCTCAGGTTGTTATACCCTATCGTTGTGAGCCTTATGACATCATGTACCTTAGGCCAATGGGAGATCTGGGACAGTTAATATTCATGGACTGGAATGCAAAGGACAAAGACACCATTAGAAAAGCCCTGGAAAACTCCAACGTTGTCATTAACCTAATCGGAAAAGAGTGGGAAACAAAGAATTTTAGTTATGAAGATGTTTTTGTGAATATTCCGAGAGATCTTGCACTGCTAGCACGGGAGGCTGGAGTAGAGAAATTCATCCACATGTCCCATCTTAACGCTGACCTGAAAAGCCCATCAAAGTATCTGAGGAATAAGGCTGTTGGAGAGGCCGCTGTAAGGGAGGCTTTCCCAGACGCAATCATCATGAAGCCTTCAGAAATGTACGGCAGGGAAGACAGATTCTTCAACCATTATGCAAACATGCGATGNTTTTGGTGGAGTGCCTCTCATTGCCCTTTGGGAAGGAAAACTGTTAAACAACCCAAGTTAATTTTGGTCGATGTTGGCCCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGTTACCTTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839073
dbEST ID: 79656775
Trimmed Sequence: ATGGTTTACAGTGTTTGCAGGTTTTGCTTCATCCAGATCAGCCTCCAGCCAGCGGTATCTGCGATGGCGACGCAGGACCTCTATTGCCTTTTGCTCCACGGACACTGGAACGATGCCGAGATCCTCCAGTCCGGGAAGGTCAGGGAACTTCTTATCCGTAGTGTGGAATCGATCAAGCTTGTCCCGGGTTATCCATGGCTCGAAGGGGTTGATCTCAAAGAATCTTGCAATTAAGCGGTAAAGAGGACGAGGTATTGGATAAGGGACAAAAGGTCTATGGGCCACAGCAAACACATACTCTACCAAATCGTGGAGAAGGTAGCGGTTAGGACCAGCCAACGCATATGTTTTCCCATTGGATTCAGGATCATGGATAGCATTTAGAATTGCCTTGGCCACATCGACCACATAAACTGGTTGTTTAACAGTTTTCTTCCCAAAGGCAATGAGAGGCACTCCACCAAACCATCGCATGTTTGCATAATGGTTGAAGAATCTGTCTTCCCTGCCGTACATTTCTGAAGGCTTCATGATGATTGCGTCCTGGAAAGCCTCCCTTACAGCGGCCTCTCCAACACCCTTATCCTCAAAAACTTTGATGGGCTTTTCAGGGCCACGTTAAAGATGGGACATGTGGGATGAATTTCTCAACTCCCGCCCTCCCCGGGGCAACCATTGCAAAAAACTTTCCCGAAATATTCACAAAAAACATCTCTTCAATAACTAAAAAATTTCTTTTGTTTTCCCCACCCTCTTTTTCTCCAAAA
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATNAGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGGTTTACAGTGTTTGCAGGTTTTGCTTCATCCAGATCAGCCTCCAGCCAGCGGTATCTGCGATGGCGACGCAGGACCTCTATTGCCTTTTGCTCCACGGACACTGGAACGATGCCGAGATCCTCCAGTCCGGGAAGGTCAGGGAACTTCTTATCCGTAGTGTGGAATCGATCAAGCTTGTCCCGGGTTATCCATGGCTCGAAGGGGTTGATCTCAAAGAATCTTGCAATTAAGCGGTAAAGAGGACGAGGTATTGGATAAGGGACAAAAGGTCTATGGGCCACAGCAAACACATACTCTACCAAATCGTGGAGAAGGTAGCGGTTAGGACCAGCCAACGCATATGTTTTCCCATTGGATTCAGGATCATGGATAGCATTTAGAATTGCCTTGGCCACATCGACCACATAAACTGGTTGTTTAACAGTTTTCTTCCCAAAGGCAATGAGAGGCACTCCACCAAACCATCGCATGTTTGCATAATGGTTGAAGAATCTGTCTTCCCTGCCGTACATTTCTGAAGGCTTCATGATGATTGCGTCCTGGAAAGCCTCCCTTACAGCGGCCTCTCCAACACCCTTATCCTCAAAAACTTTGATGGGCTTTTCAGGGCCACGTTAAAGATGGGACATGTGGGATGAATTTCTCAACTCCCGCCCTCCCCGGGGCAACCATTGCAAAAAACTTTCCCGAAATATTCACAAAAAACATCTCTTCAATAACTAAAAAATTTCTTTTGTTTTCCCCACCCTCTTTTTCTCCAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGGTTTACAGTGTTTGCAGGTT