ORFeome > ndufaf2 ORF1 – XORFeome v1.0

ndufaf2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ndufaf2
Gene ID: 6253962
Gene Page ID: 6031728
ORF Xenbase ID: 17285967

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084815
Original XGC clone length: 501

Human orthology & disease relationships

NCBI Entrez ID: 91942
Ensembl gene IDs: ENSG00000164182
Directly associated (OMIM) disease MIM numbers: 252010,256000
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ840063
dbEST ID: 79657765
Trimmed Sequence: ATGGAGAAACTACGTTGTTTGCTGCAGAGAACTTTGGGCACAGTCCGGCACCACATGGGCACAGACCAGTTTGGCAATAAATACTATTTTGTCCCTCAGCAGAAAACATGGACAGGTCGCTCTTTTAGAGAGAGAAGATTTGTGGACCCAGTGAATAAAAACACACATGAATATCAGCTCGGCCACATCCCTACAGAATGGGAGGCCTGGATCAGAGGCAAGCGGAAAAATCCTCCGACAATCGAGGAAATACTTCAAAATGAAAAATCAAGAGAAGAGATAAAAACCAAGGCAGAAGAAGCTTTGGAGAGGGACACATTAAATCTCGCAGCAGGACACAGAGACGGGCTCGTTGCTCAGCCAGGCAAGACTCAGATTAAAGGACATGCCTCCGCCACGCTGTTTGGGAAGCAAGTGCCCTCGGAGGAGCCATCCAGCACTGCTAACACCTTTCAACCGGGATCCTGGGCCGCACCGGCAGCTGCAGACCAAAAGAAGTT
Full Trace Sequence: CTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGAAACTACGTTGTTTGCTGCAGAGAACTTTGGGCACAGTCCGGCACCACATGGGCACAGACCAGTTTGGCAATAAATACTATTTTGTCCCTCAGCAGAAAACATGGACAGGTCGCTCTTTTAGAGAGAGAAGATTTGTGGACCCAGTGAATAAAAACACACATGAATATCAGCTCGGCCACATCCCTACAGAATGGGAGGCCTGGATCAGAGGCAAGCGGAAAAATCCTCCGACAATCGAGGAAATACTTCAAAATGAAAAATCAAGAGAAGAGATAAAAACCAAGGCAGAAGAAGCTTTGGAGAGGGACACATTAAATCTCGCAGCAGGACACAGAGACGGGCTCGTTGCTCAGCCAGGCAAGACTCAGATTAAAGGACATGCCTCCGCCACGCTGTTTGGGAAGCAAGTGCCCTCGGAGGAGCCATCCAGCACTGCTAACACCTTTCAACCGGGATCCTGGGCCGCACCGGCAGCTGCAGACCAAAAGAAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCAATAGTGAGTCGTATTACATGGGTCATAACAATAATCTGGAAAAAAAATGTACTTGTCCCAAATCTCCGAATAGAACAAAAAAAAGGGGCCAATTTTCCCCCCCACCCGGGTGGAGGGGGGGGGCCCTCTCGGTGAAAATGTGTTGTTTGCGGGCACCGCCGCTCTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAAACTACGTTGTTTGCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ840062
dbEST ID: 79657764
Trimmed Sequence: CTTCTTTTGGTCTGCAGCTGCCGGTGCGGCCCAGGATCCCGGTTGAAAGGTGTTAGCAGTGCTGGATGGCTCCTCCGAGGGCACTTGCTTCCCAAACAGCGTGGCGGAGGCATGTCCTTTAATCTGAGTCTTGCCTGGCTGAGCAACGAGCCCGTCTCTGTGTCCTGCTGCGAGATTTAATGAGTCCCTCTCCAAAGCTTCTTCTGCCTTGGTTTTTATCTCTTCTCTTGATTTTTCATTTTGAAGTATTTCCTCGATTGTCGGAGGATTTTTCCGCTTGCCTCTGATCCAGGCCTCCCATTCTGTAGGGATGTGGCCGAGCTGATATTCATGTGTGTTTTTATTCACTGGGTCCACAAATCTTCTCTCTCTAAAAGAGCGACCTGTCCATGTTTTCTGCTGAGGGACAAAATAGTATTTATTGCCAAACTGGTCTGTGCCCATGTGGTGCCGGACTGTGCCCAAAGTTCTCTGCAGCACACAACGTAGTTTCTCCATGG
Full Trace Sequence: GAAACGGCTTATGACCATGTAATACGACTCACTACTAGGGGAGATCAGCCTGGATGGCAAAAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCTTTTGGTCTGCAGCTGCCGGTGCGGCCCAGGATCCCGGTTGAAAGGTGTTAGCAGTGCTGGATGGCTCCTCCGAGGGCACTTGCTTCCCAAACAGCGTGGCGGAGGCATGTCCTTTAATCTGAGTCTTGCCTGGCTGAGCAACGAGCCCGTCTCTGTGTCCTGCTGCGAGATTTAATGAGTCCCTCTCCAAAGCTTCTTCTGCCTTGGTTTTTATCTCTTCTCTTGATTTTTCATTTTGAAGTATTTCCTCGATTGTCGGAGGATTTTTCCGCTTGCCTCTGATCCAGGCCTCCCATTCTGTAGGGATGTGGCCGAGCTGATATTCATGTGTGTTTTTATTCACTGGGTCCACAAATCTTCTCTCTCTAAAAGAGCGACCTGTCCATGTTTTCTGCTGAGGGACAAAATAGTATTTATTGCCAAACTGGTCTGTGCCCATGTGGTGCCGGACTGTGCCCAAAGTTCTCTGCAGCACACAACGTAGTTTCTCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATTAAAAAGCATTGCTCATCAATTTGTTGCAACAAACAGGTCACTATCATTCAAAATTAAAACAAAAAATTAAGAAAAAAAAAAAAAAATGGTCGTCTTTCTCAAAAAGGGGGGGGAAAAAAGGCATAAAATAAAAAAACCCTGGGGGGGGGGGGGGGGCCTCGGTTGAACTGGGGTGTGGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCTTTTGGTCTGCAGC