ORFeome > ndufb5 ORF1 – XORFeome v1.0

ndufb5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ndufb5
Gene ID: 970657
Gene Page ID: 970651
ORF Xenbase ID: 17286003

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041310
Original XGC clone length: 561

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11009
Well Location: B07

Sequences - 5ʹ (forward) EST

Accession: JZ823751
dbEST ID: 79641453
Trimmed Sequence: ATGGCGGGGATGAGCCTGCTAAGCTCGGCAGTGGCTGCTGCAAGGCGCTTGCCCTTCACTAACCGCGGGTTGTTTGCTGGATGCGTTCTCAGGAAGAGTCTACCGCAGCCGGGGAATGTGTCTGTGCGATTTGGCAGCCATGGAAAAAGACTGTTTGTAATGCAGCCTTCCCATTTCTATGACAGGAGATTTCTGCGTCTGCTGAAATTCTATATTTTGTTAACTGCAGTACCTGCAGCTGCATTTATAACTTTTGTCAACATTTTCATTGGTGAAGCAGAGCTAGCAGAAATTCCAGAAGGTTATGTTCCAGAGCATTGGGAATATTACAAGCATCCAATCACTCGGTGGCTTTGTCGCAACGTGTTTGACTCCCCTGAAAAGGAATATGAAAAAATGATGGCATTGATCGACATGGAAGCAGAAAAAGCTGACTTCCGACTGAAAAAATTGGAAGCTCGTCGCCTGATGAGAGAGAGAGGAGATGGCCCATGGTATCATTATGAAACCTCAGATAAAAACCTAATTGATTATGGACACAAGGCAACACCTGATGAATT
Full Trace Sequence: CAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGGGATGAGCCTGCTAAGCTCGGCAGTGGCTGCTGCAAGGCGCTTGCCCTTCACTAACCGCGGGTTGTTTGCTGGATGCGTTCTCAGGAAGAGTCTACCGCAGCCGGGGAATGTGTCTGTGCGATTTGGCAGCCATGGAAAAAGACTGTTTGTAATGCAGCCTTCCCATTTCTATGACAGGAGATTTCTGCGTCTGCTGAAATTCTATATTTTGTTAACTGCAGTACCTGCAGCTGCATTTATAACTTTTGTCAACATTTTCATTGGTGAAGCAGAGCTAGCAGAAATTCCAGAAGGTTATGTTCCAGAGCATTGGGAATATTACAAGCATCCAATCACTCGGTGGCTTTGTCGCAACGTGTTTGACTCCCCTGAAAAGGAATATGAAAAAATGATGGCATTGATCGACATGGAAGCAGAAAAAGCTGACTTCCGACTGAAAAAATTGGAAGCTCGTCGCCTGATGAGAGAGAGAGGAGATGGCCCATGGTATCATTATGAAACCTCAGATAAAAACCTAATTGATTATGGACACAAGGCAACACCTGATGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCAGTCCAGCTGATATCCCCCTATAGTGAGTCGTATTACATGGGTCATAGCTGTTTCCTGGCGCTCTGGCTCAAACACATAAAACTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAAACAACCCAAAAAATATTAACTTTTTTCCCCTCCCCTTTTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGGGATGAGCCTGCTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829060
dbEST ID: 79646762
Trimmed Sequence: TTCATCAGGTGTTGCCTTGTGTCCATAATCAATTAGGTTTTTATCTGAGGTTTCATAATGATACCATGGGCCATCTCCTCTCTCTCTCATCAGGCGACGAGCTTCCAATTTTTTCAGTCGGAAGTCAGCTTTTTCTGCTTCCATGTCGATCAATGCCATCATTTTTTCATATTCCTTTTCAGGGGAGTCAAACACGTTGCGACAAAGCCACCGAGTGATTGGATGCTTGTAATATTCCCAATGCTCTGGAACATAACCTTCTGGAATTTCTGCTAGCTCTGCTTCACCAATGAAAATGTTGACAAAAGTTATAAATGCAGCTGCAGGTACTGCAGTTAACAAAATATAGAATTTCAGCAGACGCAGAAATCTCCTGTCATAGAAATGGGAAGGCTGCATTACAAACAGTCTTTTTCCATGGCTGCCAAATCGCACAGACACATTCCCCGGCTGCGGTAGACTCTTCCTGAGAACGCATCCAGCAAACAACCCGCGGTTAGTGAAGGGCAAGCGCCTTGCAGCAGCCACTGCCGAGCTAAGCATGCTCATCCCCGCCATGG
Full Trace Sequence: GCCAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCATCAGGTGTTGCCTTGTGTCCATAATCAATTAGGTTTTTATCTGAGGTTTCATAATGATACCATGGGCCATCTCCTCTCTCTCTCATCAGGCGACGAGCTTCCAATTTTTTCAGTCGGAAGTCAGCTTTTTCTGCTTCCATGTCGATCAATGCCATCATTTTTTCATATTCCTTTTCAGGGGAGTCAAACACGTTGCGACAAAGCCACCGAGTGATTGGATGCTTGTAATATTCCCAATGCTCTGGAACATAACCTTCTGGAATTTCTGCTAGCTCTGCTTCACCAATGAAAATGTTGACAAAAGTTATAAATGCAGCTGCAGGTACTGCAGTTAACAAAATATAGAATTTCAGCAGACGCAGAAATCTCCTGTCATAGAAATGGGAAGGCTGCATTACAAACAGTCTTTTTCCATGGCTGCCAAATCGCACAGACACATTCCCCGGCTGCGGTAGACTCTTCCTGAGAACGCATCCAGCAAACAACCCGCGGTTAGTGAAGGGCAAGCGCCTTGCAGCAGCCACTGCCGAGCTAAGCATGCTCATCCCCGCCATGGTGCCAAGTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCATCAATTTGTTGCAACGAACAAGTCACTATCATTCAAAAAAAAATCATATTTGGGGCCGGAGCTTAAGAATGGCCATATTAAAAAAACAAACTGTAAGGGGGGAAATAATTTCGGCAACCTTTTTTCACCTTATATATAACAACGCGGATGTGGTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCATCAGGTGTTGCCTTGT