ORFeome > ndufs4 ORF1 – XORFeome v1.0

ndufs4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ndufs4
Gene ID: 947423
Gene Page ID: 947418
ORF Xenbase ID: 17286027

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078596
Original XGC clone length: 501

Human orthology & disease relationships

NCBI Entrez ID: 4724
Ensembl gene IDs: ENSG00000164258
Directly associated (OMIM) disease MIM numbers: 252010,256000
Indirectly associated (Lage, et al.) disease MIM numbers: 252010

Library Location

Plate ID: GDExl11004
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ839704
dbEST ID: 79657406
Trimmed Sequence: ATGGCGTCTTCAATGTCACCAGCGTTGAGGCAGCTGCTATGGGGAAGCCGAACAGTAATAAACTCACACAGGTCACTGAGCGCTTCCACATGGAGACTGGCACAGACCCAAGCTAAAGACACGCAACTCATCACGGTTGATGAAAAAATGGATATATCTACCATAAGTGGTGTTCCAGAGGAGCACATCAAAACAAGAAAAGTCCACATTTTTGTTCCTGCACGGAATGCAATGCAGTCTGGTGTGCAAAACACAAAGAGATGGAAGATGGAATTTGACACTCGGGAGCGCTGGGAAAACCCTTTAATGGGATGGGCATCAACGGCGGATCCTTTGTCTAATATGGTGCTGTCCTTTTCTTCCAAAGAAGATGCTATCTCTTTCGCTGAAAAGAATGGATGGAGCTATGAAGTTGATGAGAAGAGGATTCCAAAACTAAAATCCAAGTCTTACGGAGCAAATTTTTCTTGGAACAAGCGAACCAGGGTATCCACAAAATT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGTCTTCAATGTCACCAGCGTTGAGGCAGCTGCTATGGGGAAGCCGAACAGTAATAAACTCACACAGGTCACTGAGCGCTTCCACATGGAGACTGGCACAGACCCAAGCTAAAGACACGCAACTCATCACGGTTGATGAAAAAATGGATATATCTACCATAAGTGGTGTTCCAGAGGAGCACATCAAAACAAGAAAAGTCCACATTTTTGTTCCTGCACGGAATGCAATGCAGTCTGGTGTGCAAAACACAAAGAGATGGAAGATGGAATTTGACACTCGGGAGCGCTGGGAAAACCCTTTAATGGGATGGGCATCAACGGCGGATCCTTTGTCTAATATGGTGCTGTCCTTTTCTTCCAAAGAAGATGCTATCTCTTTCGCTGAAAAGAATGGATGGAGCTATGAAGTTGATGAGAAGAGGATTCCAAAACTAAAATCCAAGTCTTACGGAGCAAATTTTTCTTGGAACAAGCGAACCAGGGTATCCACAAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAACTCAAGACGTGTCCAAAATCCTATAAAAGTACAAAAAAAAAGAAAGAAAAAAACNNNGNACTTGCCCAAAAGGGGGGGGGGGTTATTTTGTTTGTGGGAGGGGAGAACCCCGTCGCGGAGATTCACAAGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGTCTTCAATGTCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839703
dbEST ID: 79657405
Trimmed Sequence: TTTTGTGGATACCCTGGTTCGCTTGTTCCAAGAAAAATTTGCTCCGTAAGACTTGGATTTTAGTTTTGGAATCCTCTTCTCATCAACTTCATAGCTCCATCCATTCTTTTCAGCGAAAGAGATAGCATCTTCTTTGGAAGAAAAGGACAGCACCATATTAGACAAAGGATCCGCCGTTGATGCCCATCCCATTAAAGGGTTTTCCCAGCGCTCCCGAGTGTCAAATTCCATCTTCCATCTCTTTGTGTTTTGCACACCAGACTGCATTGCATTCCGTGCAGGAACAAAAATGTGGACTTTTCTTGTTTTGATGTGCTCCTCTGGAACACCACTTATGGTAGATATATCCATTTTTTCATCAACCGTGATGAGTTGCGTGTCTTTAGCTTGGGTCTGTGCCAGTCTCCATGTGGAAGCGCTCAGTGACCTGTGTGAGTTTATTACTGTTCGGCTTCCCCATAGCAGCTGCCTCAACGCTGGTGACATTGAAGACGCCCTGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTGTGGATACCCTGGTTCGCTTGTTCCAAGAAAAATTTGCTCCGTAAGACTTGGATTTTAGTTTTGGAATCCTCTTCTCATCAACTTCATAGCTCCATCCATTCTTTTCAGCGAAAGAGATAGCATCTTCTTTGGAAGAAAAGGACAGCACCATATTAGACAAAGGATCCGCCGTTGATGCCCATCCCATTAAAGGGTTTTCCCAGCGCTCCCGAGTGTCAAATTCCATCTTCCATCTCTTTGTGTTTTGCACACCAGACTGCATTGCATTCCGTGCAGGAACAAAAATGTGGACTTTTCTTGTTTTGATGTGCTCCTCTGGAACACCACTTATGGTAGATATATCCATTTTTTCATCAACCGTGATGAGTTGCGTGTCTTTAGCTTGGGTCTGTGCCAGTCTCCATGTGGAAGCGCTCAGTGACCTGTGTGAGTTTATTACTGTTCGGCTTCCCCATAGCAGCTGCCTCAACGCTGGTGACATTGAAGACGCCCTGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACCAACAGGTCACTATCAGTCAAAATAAAATCGTTATTTTGAAAAACAAAGCAAAAAAAAAAACAAACATTACAACTACACATAAAAAGGGAAGAACCCGGGAAAAAAAATAACCTCTCTCCCTTCTCACAGGGGGGGGGTGGGGTTGTTTGTGTGGGTGGGGGGGAAGGGACCCCAAACAAAAAAAAAAAAAAAGAAAAAATAGAATTATGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTGTGGATACCCTGGTTCGCT