ORFeome > ndufs8 ORF1 – XORFeome v1.0

ndufs8 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ndufs8
Gene ID: 6254334
Gene Page ID: 945876
ORF Xenbase ID: 17286051

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078569
Original XGC clone length: 624

Human orthology & disease relationships

NCBI Entrez ID: 4728
Ensembl gene IDs: ENSG00000110717
Directly associated (OMIM) disease MIM numbers: 256000
Indirectly associated (Lage, et al.) disease MIM numbers: 256000

Library Location

Plate ID: GDExl11004
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: JZ839645
dbEST ID: 79657347
Trimmed Sequence: ATGCTGGGTGCACGTCTCATCTATAATGCTGCTAAACGACCAGGTATTCCTCCGGTGTTGTCAAGGTCTCTCAGTCTTGCCTCACAGATGCATTCATACAAATATGTTAATGCTCGAGAGGAGGCAACAGACCTAAAGTCTGTAACTGATCGTGCAGCCCAGACCTTACTTTGGACAGAGCTTTTTAGAGGTCTAGGAATGACCCTGAGTTATATGTTCCGAGAGCCAGCAACTATTAATTACCCATTTGAGAAAGGTCCTCTAAGTCCACGGTTCCGTGGTGAGCATGCATTACGTAGGTATCCATCGGGTGAGGAGCGCTGCATCGCCTGCAAACTCTGTGAGGCAGCCTGCCCTGCTCAGGCAATTACAATTGAAGCAGAGCCACGTGCAGATGGAAGCCGTCGAACTACAAGATATGACATTGACATGACAAAGTGTATCTATTGTGGGTTCTGCCAGGAGGCATGCCCCGTAGATGCAATTGTGGAGGGCCCAAACTTTGAGTTCAGCACGGAGACTCATGAAGAACTTTTATACAACAAGGAGAAACTTCTAAATAATGGAGACAAGTGGGAAGTTGAGATTGGAGCAAATATTCAAGCTGATTTCCTTTACCGTTT
Full Trace Sequence: TCGGGGGCCTACATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGGGTGCACGTCTCATCTATAATGCTGCTAAACGACCAGGTATTCCTCCGGTGTTGTCAAGGTCTCTCAGTCTTGCCTCACAGATGCATTCATACAAATATGTTAATGCTCGAGAGGAGGCAACAGACCTAAAGTCTGTAACTGATCGTGCAGCCCAGACCTTACTTTGGACAGAGCTTTTTAGAGGTCTAGGAATGACCCTGAGTTATATGTTCCGAGAGCCAGCAACTATTAATTACCCATTTGAGAAAGGTCCTCTAAGTCCACGGTTCCGTGGTGAGCATGCATTACGTAGGTATCCATCGGGTGAGGAGCGCTGCATCGCCTGCAAACTCTGTGAGGCAGCCTGCCCTGCTCAGGCAATTACAATTGAAGCAGAGCCACGTGCAGATGGAAGCCGTCGAACTACAAGATATGACATTGACATGACAAAGTGTATCTATTGTGGGTTCTGCCAGGAGGCATGCCCCGTAGATGCAATTGTGGAGGGCCCAAACTTTGAGTTCAGCACGGAGACTCATGAAGAACTTTTATACAACAAGGAGAAACTTCTAAATAATGGAGACAAGTGGGAAGTTGAGATTGGAGCAAATATTCAAGCTGATTTCCTTTACCGTTTGCCAACTTCTTGTACAAAGTTGGCATTAATAAAAAGCATTGCTTAACAATTTGTTGCAACGAACAAGTCACTATTAATCAAAATAAAATCATTATTTGGCCATCAGCTGAAATCCCCCATAGTGAATCGTATAAAATTGGTCATAACCTGATAAATAAAAAAAAAAAAAACCAATATCAAAAAAAAATATATACAAAAGTTAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGGGTGCACGTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839644
dbEST ID: 79657346
Trimmed Sequence: ACGGTAAAGGAAATCAGCTTGAATATTTGCTCCAATCTCAACTTCCCACTTGTCTCCATTATTTAGAAGTTTCTCCTTGTTGTATAAAAGTTCTTCATGAGTCTCCGTGCTGAACTCAAAGTTTGGGCCCTCCACAATTGCATCTACGGGGCATGCCTCCTGGCAGAACCCACAATAGATACACTTTGTCATGTCAATGTCATATCTTGTAGTTCGACGGCTTCCATCTGCACGTGGCTCTGCTTCAATTGTAATTGCCTGAGCAGGGCAGGCTGCCTCACAGAGTTTGCAGGCGATGCAGCGCTCCTCACCCGATGGATACCTACGTAATGCATGCTCACCACGGAACCGTGGACTTAGAGGACCTTTCTCAAATGGGTAATTAATAGTTGCTGGCTCTCGGAACATATAACTCAGGGTCATTCCTAGACCTCTAAAAAGCTCTGTCCAAAGTAAGGTCTGGGCTGCACGATCAGTTACAGACTTTAGGTCTGTTGCCTCCTCTCGAGCATTAACATATTTGTATGAATGCATCTGTGAAGCAAGACTGAGAGACCTTGACAACACCGGAAGAATACCTGGTCGTTTAGCAGCATTATAGATGAGACGTGCACCCAGCATGGTGCCGACCTTTTTTTACAAAAGTTGCATTAATAAAAAGCCATGCTCAACAATTGGTTGCAACAAAAAGGTCACTATAAGTTCAAAAAAAAAAACAATAAATAAGAGGGCACAAAACATAAAAAACTGGGCCGCTTAAAAAAAGAACACACCCAAC
Full Trace Sequence: AAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACGGTAAAGGAAATCAGCTTGAATATTTGCTCCAATCTCAACTTCCCACTTGTCTCCATTATTTAGAAGTTTCTCCTTGTTGTATAAAAGTTCTTCATGAGTCTCCGTGCTGAACTCAAAGTTTGGGCCCTCCACAATTGCATCTACGGGGCATGCCTCCTGGCAGAACCCACAATAGATACACTTTGTCATGTCAATGTCATATCTTGTAGTTCGACGGCTTCCATCTGCACGTGGCTCTGCTTCAATTGTAATTGCCTGAGCAGGGCAGGCTGCCTCACAGAGTTTGCAGGCGATGCAGCGCTCCTCACCCGATGGATACCTACGTAATGCATGCTCACCACGGAACCGTGGACTTAGAGGACCTTTCTCAAATGGGTAATTAATAGTTGCTGGCTCTCGGAACATATAACTCAGGGTCATTCCTAGACCTCTAAAAAGCTCTGTCCAAAGTAAGGTCTGGGCTGCACGATCAGTTACAGACTTTAGGTCTGTTGCCTCCTCTCGAGCATTAACATATTTGTATGAATGCATCTGTGAAGCAAGACTGAGAGACCTTGACAACACCGGAAGAATACCTGGTCGTTTAGCAGCATTATAGATGAGACGTGCACCCAGCATGGTGCCGACCTTTTTTTACAAAAGTTGCATTAATAAAAAGCCATGCTCAACAATTGGTTGCAACAAAAAGGTCACTATAAGTTCAAAAAAAAAAACAATAAATAAGAGGGCACAAAACATAAAAAACTGGGCCGCTTAAAAAAAGAACACACCCAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGGTAAAGGAAATCAGCTTGAA