ORFeome > ndufv1 ORF1 – XORFeome v1.0

ndufv1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ndufv1
Gene ID: 495067
Gene Page ID: 495062
ORF Xenbase ID: 17286057

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041320
Original XGC clone length: 1416

Human orthology & disease relationships

NCBI Entrez ID: 4723
Ensembl gene IDs: ENSG00000167792
Directly associated (OMIM) disease MIM numbers: 252010
Indirectly associated (Lage, et al.) disease MIM numbers: 145500,203450,245349,252010,256000,607322

Library Location

Plate ID: GDExl11010
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ823745
dbEST ID: 79641447
Trimmed Sequence: ATGCTTTCCCTAAGACATATAGTGAGAATTCCTCTTCCCTCTCCTGCTTCCACCATTGTTCTTGCCAGATTCAACTCTAGTGGACCTGATCAGACTCCAAAAAAGACAAAATTTGGACCTCTTAGTGACGAAGATCGAATATTTACCAACTTATATGGACGTCATGACTGGGGATTGAAAGGTGCTTTAAGTAGAGGAGACTGGTACAAGACCAAGGAGATTTTGTTGAAGGGAGTAGACTGGATTCAGGGTGAGGTTAAAACTTCTGGCCTGCGTGGCAGAGGAGGAGCTGGCTTCCCAACAGGTCTTAAATGGAGCTTTATGAATAAACCATCAGATGGAAGGCCCAAATATCTTGTAGTCAATGCAGATGAAGGTGAACCTGGAACATGTAAGGATCGGGAGATCATGAGACACGACCCCCACAAACTTGTGGAGGGTTGTCTAGTTGCTGGACGTAGCATGGGAGCTCGTGCAGCATACATCTACATTCGAGGAGAATTCTACAATGAAGCATCCAATCTACAGGTAGCTGTGCGGGAGGCATACTCTGCGGGGCTTATTGGGCGTAATGCCTGTGGCTCAGGGTATGATTTTGATGTGTTTGTGGTGAGAGGCGCTGGGGCATACATCTGTGGTGAAGAGACTGCATTGATTGAGAGCATTGAAGGAAAACAAGGAAAACCCCGCCTTAAGCCTCCCTTTCCTGCTGATGTTGGTGTTTTTTGTTTGTCCACAACAGTTGCCAATGTTGAAAACTGTTTGCAGTTGCCCCGACCATTTGGC
Full Trace Sequence: AATTGATTTTTATTATTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTTTCCCTAAGACATATAGTGAGAATTCCTCTTCCCTCTCCTGCTTCCACCATTGTTCTTGCCAGATTCAACTCTAGTGGACCTGATCAGACTCCAAAAAAGACAAAATTTGGACCTCTTAGTGACGAAGATCGAATATTTACCAACTTATATGGACGTCATGACTGGGGATTGAAAGGTGCTTTAAGTAGAGGAGACTGGTACAAGACCAAGGAGATTTTGTTGAAGGGAGTAGACTGGATTCAGGGTGAGGTTAAAACTTCTGGCCTGCGTGGCAGAGGAGGAGCTGGCTTCCCAACAGGTCTTAAATGGAGCTTTATGAATAAACCATCAGATGGAAGGCCCAAATATCTTGTAGTCAATGCAGATGAAGGTGAACCTGGAACATGTAAGGATCGGGAGATCATGAGACACGACCCCCACAAACTTGTGGAGGGTTGTCTAGTTGCTGGACGTAGCATGGGAGCTCGTGCAGCATACATCTACATTCGAGGAGAATTCTACAATGAAGCATCCAATCTACAGGTAGCTGTGCGGGAGGCATACTCTGCGGGGCTTATTGGGCGTAATGCCTGTGGCTCAGGGTATGATTTTGATGTGTTTGTGGTGAGAGGCGCTGGGGCATACATCTGTGGTGAAGAGACTGCATTGATTGAGAGCATTGAAGGAAAACAAGGAAAACCCCGCCTTAAGCCTCCCTTTCCTGCTGATGTTGGTGTTTTTTGTTTGTCCACAACAGTTGCCAATGTTGAAAACTGTTTGCAGTTGCCCCGACCATTTGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTTTCCCTAAGACATATAGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829054
dbEST ID: 79646756
Trimmed Sequence: AAATGTTTTGCTAGCTTGCTGTCTCTTTGCGGTGTCAAAAAGTTTCATGCGCTGCTCCAACTCAGGGCGGAAATGACGAATCAAACCCTGGACAGGCCAGGCAGCCCCATCTCCCAATGCACAAATGGTGTGTCCTTCAATCTGCTTGCTAATCTCCCACAACATGTCGATCTCATCTACATGGGCATCACCTCGACACATACGCCACATAACTTTGTTCATCCAGTCAACACCTTCCCTGCAGGGAGTACACTGACCACAGCTCTCATGTTTGTAGAATTCAATAAGGCGTGCAATTGCACGGACAATGTCAGTTGATTTATTCATGACAATGATCGCTGCTGTACCAAGACCAGTCTGAGCCTGGACTAGAGCATCAAAATCCATAAGAACTGTTTCACACACAGATCGTGGTATAAGTGGTNGTGGAGGAGCCTCCGGGGATTACAGCAAGAAGATTATCCCAGCCACCAGTAACTCCTCCTGCATGCCTTTCAATGAGCTCTTTAAGTGGTATAGACATTTCTTCCTCCACAGTACATGGATTGTTTACATGTCCCGATATGTTGAACAGTTTGGTACCAGAGTTTCTTTCACGACCAAAGCTAGCAAACCAGGAACCTCCACGCCTGCAAATGGTCGGGGCAACTGGCACAGTTTCCACAATGGGCAACTGTTGTTTGGACAACCAAAACACCAACATTCACAAGGAAAGGGAGGCTTTAAAGGGGGGGGTTTTTCCTTTGTTTTCCTTTAAGGGTCTTTTAAATCA
Full Trace Sequence: TGCCAGGTAGCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAATGTTTTGCTAGCTTGCTGTCTCTTTGCGGTGTCAAAAAGTTTCATGCGCTGCTCCAACTCAGGGCGGAAATGACGAATCAAACCCTGGACAGGCCAGGCAGCCCCATCTCCCAATGCACAAATGGTGTGTCCTTCAATCTGCTTGCTAATCTCCCACAACATGTCGATCTCATCTACATGGGCATCACCTCGACACATACGCCACATAACTTTGTTCATCCAGTCAACACCTTCCCTGCAGGGAGTACACTGACCACAGCTCTCATGTTTGTAGAATTCAATAAGGCGTGCAATTGCACGGACAATGTCAGTTGATTTATTCATGACAATGATCGCTGCTGTACCAAGACCAGTCTGAGCCTGGACTAGAGCATCAAAATCCATAAGAACTGTTTCACACACAGATCGTGGTATAAGTGGTNGTGGAGGAGCCTCCGGGGATTACAGCAAGAAGATTATCCCAGCCACCAGTAACTCCTCCTGCATGCCTTTCAATGAGCTCTTTAAGTGGTATAGACATTTCTTCCTCCACAGTACATGGATTGTTTACATGTCCCGATATGTTGAACAGTTTGGTACCAGAGTTTCTTTCACGACCAAAGCTAGCAAACCAGGAACCTCCACGCCTGCAAATGGTCGGGGCAACTGGCACAGTTTCCACAATGGGCAACTGTTGTTTGGACAACCAAAACACCAACATTCACAAGGAAAGGGAGGCTTTAAAGGGGGGGGTTTTTCCTTTGTTTTCCTTTAAGGGTCTTTTAAATCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAATGTTTTGCTAGCTTGCTGTC