ORFeome > nek6 ORF1 – XORFeome v1.0

nek6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nek6
Gene ID: 956757
Gene Page ID: 956750
ORF Xenbase ID: 17286111

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044326
Original XGC clone length: 933

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11009
Well Location: C04

Sequences - 5ʹ (forward) EST

Accession: JZ823715
dbEST ID: 79641417
Trimmed Sequence: ATGGAAGGACCGCATCGACTAGAAGACCAAAACAACCCTATGTGCAAAGTTCAGGGGCAGGAATACCAGCACGAGGGCCAAAGACACATGACTTCCTATCCCTACCGGTGCACATTGGCAGACTTCAAGATAGAGAAGAAGATTGGGCGGGGGCAATTCAGTGAGGTCTACAAAGCCACCTGCCACTTGGACAGAAAGCCTGTGGCCCTGAAAAAAGTTCAGATATTTGAAATGATGGACGCCAAAGCTAGACAAGACTGTATTAAAGAAATTGATCTCTTAAAGCAACTGAACCATCCAAATGTAATCAAGTATTTGGATTCCTTTATTGAAGACAATGAGCTGAACATTGTTCTGGAGATTGCGGATGCCGGAGACCTCTCTCAGATGATTAAATACTTTAAAAAGCAAAAGCGGTTAATTCCAGAGAGGACTGTGTGGAAATATTTTGTGCAGTTATGCAGCGCTGTGGAACATATGCATTCCCGTAGAATCATGCACAGAGACATAAAGCCTGCTAACATGTTTATCACAGCCACAGGGGTGGTGAAACTGGGAGACCTCGGGCTAGGGCGATTTTTCAGCTCCAAAACCACCGCAGCACATTCCTTGGTGGGAACACCATATTACATGTCCCCAGAAAGAATCCATGAAAATGGCTACNATTTCAAGTCAGATATCTGGGTCTTAGGATGTCTGCTGTATGAAATGGCAGCTTTACAGAGTCCTTTCTATGGGGGACAAAATTGAACCGGTTTTCCCTGGTGTCAGAAGAATA
Full Trace Sequence: CCAGTAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGGACCGCATCGACTAGAAGACCAAAACAACCCTATGTGCAAAGTTCAGGGGCAGGAATACCAGCACGAGGGCCAAAGACACATGACTTCCTATCCCTACCGGTGCACATTGGCAGACTTCAAGATAGAGAAGAAGATTGGGCGGGGGCAATTCAGTGAGGTCTACAAAGCCACCTGCCACTTGGACAGAAAGCCTGTGGCCCTGAAAAAAGTTCAGATATTTGAAATGATGGACGCCAAAGCTAGACAAGACTGTATTAAAGAAATTGATCTCTTAAAGCAACTGAACCATCCAAATGTAATCAAGTATTTGGATTCCTTTATTGAAGACAATGAGCTGAACATTGTTCTGGAGATTGCGGATGCCGGAGACCTCTCTCAGATGATTAAATACTTTAAAAAGCAAAAGCGGTTAATTCCAGAGAGGACTGTGTGGAAATATTTTGTGCAGTTATGCAGCGCTGTGGAACATATGCATTCCCGTAGAATCATGCACAGAGACATAAAGCCTGCTAACATGTTTATCACAGCCACAGGGGTGGTGAAACTGGGAGACCTCGGGCTAGGGCGATTTTTCAGCTCCAAAACCACCGCAGCACATTCCTTGGTGGGAACACCATATTACATGTCCCCAGAAAGAATCCATGAAAATGGCTACNATTTCAAGTCAGATATCTGGGTCTTAGGATGTCTGCTGTATGAAATGGCAGCTTTACAGAGTCCTTTCTATGGGGGACAAAATTGAACCGGTTTTCCCTGGTGTCAGAAGAATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGGACCGCATCGACTAGAA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGCGCACCGCGAAGAACGCGACACGTGGACTCGTGCTCTATCTCCCATCCTCACTGAGTGAGGTGGGAGCGTCGGCGCTGGGCGAGGGAAGAAGATAATGTATTGTTTGTCTTGTATTGGAGATGGCTGCGCTCGTTATCGTTCACCATATGATATAGACATAGGCTATTGCTCTATGCCTGTCCATAGCTCCTGTCCTTAGGAATAGATAGAAGAGAAAGCATAAGTTTCTTCATGTGTCCTGCGTACACATTCGTTCGTCGTTCTCTGTCTACCTATCTCCTACGCGTACTAGCACATAGTTGCATGCTTCTCTGCCTAGACACTGCCATTGTGCTCTTAGACTGAGACGCATGTGCAGTGCCACGCTGTTGCATCATGCTGTCTAATGGATCTCGCGTGTGAACAGCGAAGGACAAGCGGCCTATCCTCCCACACCATATGGTCTGAGAGCAGAATAAGAATGCGTCACAGCGAGCCGTAGTAGCTCGTAACACGAGATATCTTAGCAACCTCCTTGCAACCGACGCGACGAGAGAAGGTACTAAANTAGAGTCAATGTCGCCAGTATCCTTGGTTCTTTGTCTTGTCGTCCCTGGTAGATAGTTGGGCTTCTAATAACGTGATGTGCCTCTCATACTGATCTGGTAAAAAGAGCCTGCTGTCTCTAGCATGCCACTCGCAATATAATACATAGTAGCACTCCGCTAAGGTAGCACTAGCTACTGACGCTGAGCACATGAGTGGAAGTGCTCACTCCTACTACCTATAGCGCACGACTCGCTCGAGTAGTCAGTGCGATATCGAGCACTATCAAGTCATGCTCATAAGTGATATCATGCGCCTCGCTATTCACGATAGATGATACAAGATAGACTACACNATACAATGACTCGTGCACAAATTCTCACAATATTGATACTATAGGACGGTATTGTCTTTCACTGCTCCGTTGCTACGCGCATGCTAACTCACCACCATCTACTGAGGGATCCTTCGACAAGAAATTGTCGAACGAGATCCGTAGTTAATCGGTGCATTGATAGAGGAACTTCTCCTTTCGTCCTACTGGGGGAATTCCATTTCTCCTTTTTGCCATCAAACCTATGTACCTATTTGGCGAGGTTGGTCTTTGTAGTTTTCCCTCCCAGAACAGATTTAGGAATACATATTTCGCAACCCCAAGTTAAAACAAATTACTCCCAAAACCTTGAAATTGGCCCAAAAAGGGGGAAAAGTATTTCTCCTCCGGAGGTGTTTTTTTTCCCGGAGAGCGCCCACCTCCACCCACCCCCCCCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTGCTGGAGGTCCACGCAT