ORFeome > nelfa ORF1 – XORFeome v1.0

nelfa ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: nelfa
Gene ID: 988840
Gene Page ID: 988836
ORF Xenbase ID: 17286129

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC081231
Original XGC clone length: 1077

Human orthology & disease relationships

NCBI Entrez ID: 7469
Ensembl gene IDs: ENSG00000185049
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 214150,216400,601675

Library Location

Plate ID: GDExl11005
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ839872
dbEST ID: 79657574
Trimmed Sequence: ATGGCGCCTCCGAGCATCGCCTCTTTGCTCACGGCCTCCGTCATAGACAACGTGAGATTGTGTTTCCATAACTTGTCCTCCGCCGTCAAACTGAAGCTGCTGCTGGGGATTCTGCACCTCCCGCGCCGCACAGTGGATGAGATGAAAGGAGCACTGACGGAAATCATTCAGCTCGCCACTCTAGACTCTGACCCCTGGATACTGATGGTAGCCGATATCCTGAAATCCTTCCCTGACACAGGATCCCTGAATCTTGATCTCGAGGAACAGAATCCAAATGTGCAGGACATATTGGGAGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCGGCTATGCTGCCACTCGAATGCCAGTACCTCAACAAAAATGCCCTGACTACCCTTGCTGGACCTCTCACGCCCCCAGTGAAACATTTCCAGCTAAAACGAAAGCCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACTGCAGGGGTTCCATTTCACTCANAAGGACGAGGTCTGGTCAAAAAACTGGACACAACAACTCCTCTCANAGGTATACCANAGCAGGCACCATTCANGAGTCCAACCACACCAGGTGTATTTAGTCCGACTGCTAACAGAACACCTATNGCGCCCTCCAGAACGCCCTTTCGCAAAGGAGAGAGGTGTAAAGTTATTAGACATATCTGAAGCTTGACATGGGTCGGAGGGTGGTCGGGGAAAGCAAAGAAAAAG
Full Trace Sequence: CTCGAGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCCTCCGAGCATCGCCTCTTTGCTCACGGCCTCCGTCATAGACAACGTGAGATTGTGTTTCCATAACTTGTCCTCCGCCGTCAAACTGAAGCTGCTGCTGGGGATTCTGCACCTCCCGCGCCGCACAGTGGATGAGATGAAAGGAGCACTGACGGAAATCATTCAGCTCGCCACTCTAGACTCTGACCCCTGGATACTGATGGTAGCCGATATCCTGAAATCCTTCCCTGACACAGGATCCCTGAATCTTGATCTCGAGGAACAGAATCCAAATGTGCAGGACATATTGGGAGAGCTCAGAGAGAAAGTCAGTGAATGTGAAGCATCGGCTATGCTGCCACTCGAATGCCAGTACCTCAACAAAAATGCCCTGACTACCCTTGCTGGACCTCTCACGCCCCCAGTGAAACATTTCCAGCTAAAACGAAAGCCAAAAAGTGCCACACTCAGAGCAGAGCTCTTACAGAAATCAACAGAAACTGCACAGCAGCTGAAGAAAACTGCAGGGGTTCCATTTCACTCANAAGGACGAGGTCTGGTCAAAAAACTGGACACAACAACTCCTCTCANAGGTATACCANAGCAGGCACCATTCANGAGTCCAACCACACCAGGTGTATTTAGTCCGACTGCTAACAGAACACCTATNGCGCCCTCCAGAACGCCCTTTCGCAAAGGAGAGAGGTGTAAAGTTATTAGACATATCTGAAGCTTGACATGGGTCGGAGGGTGGTCGGGGAAAGCAAAGAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCCTCCGAGCATC

Sequences - 3ʹ (reverse) EST

Accession: JZ839871
dbEST ID: 79657573
Trimmed Sequence: ATGGAGAGGTAGGGGTTGCTGCAGGAGAAGGAGTAGTGGTGGCAGCATTTGGGTTACTGTGGTACATCGGTGTCCTTTGTTTAAACTGTGTTGGAAGAGTGGTGTTGGCTGCTGTCCTTCAGACGTTGGAATGTAGGAGGAGGATGGCACCACACTGGGTGTTGCTGGCAAATAGCTTGTAGATGGAAGTGCACTCTCATTGTTCAAGGCACCCAGTTTCTGTGTAGAGACGAGGCCAGCAGCATAGTCTGGAGTAGGGTTTTCCAATACAGTCTCCTCCTTTGGTGGTTTCTCAACAACTTCTGCTTCAACAGTCTTTCTTCTCTTCTTCGCTTCCCGACCACCTCCGACCATGTCAAGCTCAGATATGTCTAATAACTTTACACCTCTCTCCTTGCGCAAGGGCGTTCTGGAGGGCGCTATAGGTGTTCTGTTAGCAGTCGGACTAAATACACTTGGTGTGGTTGGACTCCTGAATGGTGCCTGCTTTGGTATACCTTTGAGAGGAGTTGTTGTGTCCAGTTTTTTGACCAAACCTCGTCCTTTTGAGTGAGATGGAACCCCTGCAGTTTTCTTCAGCTGCTGTGCAGTTTCTGTTGATTTCTGTAAGAGCTCTGCTCTGAGTGTGGCACTTTTTGGCTTTCGTTTTACCTGGAAATGTTTCCCTGGGGGCGTTAAGAGGTCCAGACAGGGGTAATCCAGGGCATTT
Full Trace Sequence: CCGGAAAACAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGGAGAGGTAGGGGTTGCTGCAGGAGAAGGAGTAGTGGTGGCAGCATTTGGGTTACTGTGGTACATCGGTGTCCTTTGTTTAAACTGTGTTGGAAGAGTGGTGTTGGCTGCTGTCCTTCAGACGTTGGAATGTAGGAGGAGGATGGCACCACACTGGGTGTTGCTGGCAAATAGCTTGTAGATGGAAGTGCACTCTCATTGTTCAAGGCACCCAGTTTCTGTGTAGAGACGAGGCCAGCAGCATAGTCTGGAGTAGGGTTTTCCAATACAGTCTCCTCCTTTGGTGGTTTCTCAACAACTTCTGCTTCAACAGTCTTTCTTCTCTTCTTCGCTTCCCGACCACCTCCGACCATGTCAAGCTCAGATATGTCTAATAACTTTACACCTCTCTCCTTGCGCAAGGGCGTTCTGGAGGGCGCTATAGGTGTTCTGTTAGCAGTCGGACTAAATACACTTGGTGTGGTTGGACTCCTGAATGGTGCCTGCTTTGGTATACCTTTGAGAGGAGTTGTTGTGTCCAGTTTTTTGACCAAACCTCGTCCTTTTGAGTGAGATGGAACCCCTGCAGTTTTCTTCAGCTGCTGTGCAGTTTCTGTTGATTTCTGTAAGAGCTCTGCTCTGAGTGTGGCACTTTTTGGCTTTCGTTTTACCTGGAAATGTTTCCCTGGGGGCGTTAAGAGGTCCAGACAGGGGTAATCCAGGGCATTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGGAGAGGTAGGGGTTG