ORFeome > ngly1 ORF1 – XORFeome v1.0

ngly1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ngly1
Gene ID: 963944
Gene Page ID: 963940
ORF Xenbase ID: 17286261

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC124906
Original XGC clone length: 1908

Human orthology & disease relationships

NCBI Entrez ID: 55768
Ensembl gene IDs: ENSG00000151092
Directly associated (OMIM) disease MIM numbers: 615273
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ837366
dbEST ID: 79655068
Trimmed Sequence: ATGGCAGCGCAGGAGTCCCCTGCAGTGGACGAGTTGTGCCAGAATGAGCGGCAGGAATTCTTGGACGCCTCCCAGCTGTTACTCACCTACGCAGACAATATACTGAGGAGTCCAAATGAGGAAAAATACAGATCAATTAGGATTGGAAACACTGCATTTTCTACCAGACTTTTGCCTGTCAGAGGAGCAATCGAATGCTTGTTTGAAATGGGATTTGAAGAGGAAGAGACACACCTGGTGTTTCCAAAAATGGCTTCTGTTGAAAAGCTTCGTAACGTTAGGGACCATATAGCCATAGAAAGGAATAAGAGAATGAGTGCTGCAAACCCTACACCACCAGCTACATCCAGTACCCCGCCAGCATTCAGCAGAACCCCTGTACCAAATCCAGTTCCTCCAAGTATACCCCTGCCAGCAACAGAGGATATATCCAATTTCTTGGCTTCTGAAGTTAGATATTTAAAGACCCTCCAGTCCAACTCACAACATGTGTTAATTTATGAGGAGCCTGAAATTCAGCAAAGAGCATTACAAGAAATTCCAGTGTCGGATTTGAAAACAAGAGCCCAGAANAAGCTTATTGAAGCTAANAGTCTTGACTCTGATACCAGTGTGAATTTAGAAGATTTTTTATTGCTGGAACTACTTCGCTGGTTTAAGCAGGACTTCTTCCAGTGGGTCAATAGCCTACCTTGCAGTCACTGTGGGTGGAGGAACTCAAGGCCCGAGATGCTTTGTCTCCTTCTGATGAAAGACTTGCGCTGGGGGAGCAAATCGAGGGGAAAATCATTTAACGGTAAAAAATTTTAAACACACC
Full Trace Sequence: GGGGGCCCCAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCGCAGGAGTCCCCTGCAGTGGACGAGTTGTGCCAGAATGAGCGGCAGGAATTCTTGGACGCCTCCCAGCTGTTACTCACCTACGCAGACAATATACTGAGGAGTCCAAATGAGGAAAAATACAGATCAATTAGGATTGGAAACACTGCATTTTCTACCAGACTTTTGCCTGTCAGAGGAGCAATCGAATGCTTGTTTGAAATGGGATTTGAAGAGGAAGAGACACACCTGGTGTTTCCAAAAATGGCTTCTGTTGAAAAGCTTCGTAACGTTAGGGACCATATAGCCATAGAAAGGAATAAGAGAATGAGTGCTGCAAACCCTACACCACCAGCTACATCCAGTACCCCGCCAGCATTCAGCAGAACCCCTGTACCAAATCCAGTTCCTCCAAGTATACCCCTGCCAGCAACAGAGGATATATCCAATTTCTTGGCTTCTGAAGTTAGATATTTAAAGACCCTCCAGTCCAACTCACAACATGTGTTAATTTATGAGGAGCCTGAAATTCAGCAAAGAGCATTACAAGAAATTCCAGTGTCGGATTTGAAAACAAGAGCCCAGAANAAGCTTATTGAAGCTAANAGTCTTGACTCTGATACCAGTGTGAATTTAGAAGATTTTTTATTGCTGGAACTACTTCGCTGGTTTAAGCAGGACTTCTTCCAGTGGGTCAATAGCCTACCTTGCAGTCACTGTGGGTGGAGGAACTCAAGGCCCGAGATGCTTTGTCTCCTTCTGATGAAAGACTTGCGCTGGGGGAGCAAATCGAGGGGAAAATCATTTAACGGTAAAAAATTTTAAACACACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCGCAGGAGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ837365
dbEST ID: 79655067
Trimmed Sequence: GGCATCCTTCAACATTATAATAATCTCCAAAGAGTTTTCTTTACAGTCTAATGTTTGACGGAAAATCTGTGTGTGCTGCCATGCTGTATTTCCATCACCATCGCACAACTCAGCTTTCAACTCAACTTCTGAAGCATTTAAAAACTCAGGGTAAGAATGAAAATTTGTATCACTGTTCACTTCCACCTCTGCTTCTGGAGAAGACAACTTCCATATTATTTTACCACTGTGAAAGGTTTGACTACTGGTGCGAACACTTATACTTTCAATTTGGAGTCCTGCTGAAGCACATTCTATCTTCCAACTAATGGCAGCTGATGAGGAACCCTCAGTGCGAGCCAAATAAACCATTTTCCAGTCACTCTCAACTTTTCTACAAATAGACTCTGCTTTCCAGGCTCCATTTTCCCAGCCGGCGATAACCACATTGTTATTCGAGGTACGTGTATAGGTATCTTCAACTACGTTATACTGAAGATGGAAACGCTTGCTGGTTTTCTCACTCTCAGACGGGATAAAAATAACGCTTTTGGTCGACTGTAAACTGGTTTCACCTCTTGCCACTCTCCAGGCTACTGATCCAGAGACCCTCCCACCAAGTTCTCCTGGTTTAGTAGTCTTAGGAGACATGAATTCAACCAACTTCCACATCAGTCCTTCCAAGAGGTTCCGGCTTTCTGTGGTTCGGGGACGAACTGTTGGCTTCATTTTATTGAAAACCAACAATTGGTTTCCCCTTAGCCCACCTTTTCTCCGCCCTTCCCTTT
Full Trace Sequence: AAAACAGCTATTGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCATCCTTCAACATTATAATAATCTCCAAAGAGTTTTCTTTACAGTCTAATGTTTGACGGAAAATCTGTGTGTGCTGCCATGCTGTATTTCCATCACCATCGCACAACTCAGCTTTCAACTCAACTTCTGAAGCATTTAAAAACTCAGGGTAAGAATGAAAATTTGTATCACTGTTCACTTCCACCTCTGCTTCTGGAGAAGACAACTTCCATATTATTTTACCACTGTGAAAGGTTTGACTACTGGTGCGAACACTTATACTTTCAATTTGGAGTCCTGCTGAAGCACATTCTATCTTCCAACTAATGGCAGCTGATGAGGAACCCTCAGTGCGAGCCAAATAAACCATTTTCCAGTCACTCTCAACTTTTCTACAAATAGACTCTGCTTTCCAGGCTCCATTTTCCCAGCCGGCGATAACCACATTGTTATTCGAGGTACGTGTATAGGTATCTTCAACTACGTTATACTGAAGATGGAAACGCTTGCTGGTTTTCTCACTCTCAGACGGGATAAAAATAACGCTTTTGGTCGACTGTAAACTGGTTTCACCTCTTGCCACTCTCCAGGCTACTGATCCAGAGACCCTCCCACCAAGTTCTCCTGGTTTAGTAGTCTTAGGAGACATGAATTCAACCAACTTCCACATCAGTCCTTCCAAGAGGTTCCGGCTTTCTGTGGTTCGGGGACGAACTGTTGGCTTCATTTTATTGAAAACCAACAATTGGTTTCCCCTTAGCCCACCTTTTCTCCGCCCTTCCCTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCATCCTTCAACATTAT