ORFeome > nif3l1 ORF1 – XORFeome v1.0

nif3l1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nif3l1
Gene ID: 6078750
Gene Page ID: 1016728
ORF Xenbase ID: 17286303

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC123210
Original XGC clone length: 1035

Human orthology & disease relationships

NCBI Entrez ID: 60491
Ensembl gene IDs: ENSG00000196290
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 259900,600794,601472,606664

Library Location

Plate ID: GDExl11089
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ838347
dbEST ID: 79656049
Trimmed Sequence: ATGGATCTTGGTTCAGTGGTCTCCCACCTCAATGCACTCACCCCTCCAGCTCTGGCAGAAGGCTGGGATAATGTGGGGCTTTTAGTGGAGCCCAGTCCTCCGCACCAGGTCCACAAGCTTCTCCTGACCAATGATCTGACGGAAGATGTGCTGGACGAGGCGATAAATATGGAAGCTAATATGATTCTGTCCTATCATCCGCCAGTATTTAAAGCCTTGAAGCGCGTCACCCAGAAAAACTGGAAAGAGAGGTTGGTGGTTAAAGCCCTGGAAAAGCGCCTGGCGATATACTCTCCTCACACATCTTGTGATGCATTGGCAAACGGAGTCAATGACTGGCTGGCCAGGGCTCTAGGGCCAAGCAAGTCTGTGCCACTCCATGCATCTACTTCCCTCACGTATCCTGGTGGCTTTGGGCACCTCTTAGAGTTCAGACTAGATACTGCTGAGAACATCTTCTCCAGGCTGAAATCCATCCAGGGGGTCAGCGTCTGCACCTCCACTGCCAGCCCCGAAGGTCAAAATGTAAGCCTTAGCTGCTCCCAGAATGCATTGGTGGAGGCACTAGCTATCCTATCAGAAGAGCCACATGTGTACAACAGCCTGCAGCTCCTCAGCCTACAGAAACCTCCACTTGTGGACACCGGAATGGGACGTCTCTGCACTCTCCCCTGACCCGGTGTCTATTGCAGCTGCTGTGGAACGCTTTAAAAACACCTGCATCTCCCCTCCTCTCCCCTTGGGCCTTTGGGTAATGGCAAAACCTCTGGAACCCCCCAAATAAAAAATTGGGAACCGGTGGTTGGTGCGGGGGG
Full Trace Sequence: GACACCCAATAATAGATTTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATCTTGGTTCAGTGGTCTCCCACCTCAATGCACTCACCCCTCCAGCTCTGGCAGAAGGCTGGGATAATGTGGGGCTTTTAGTGGAGCCCAGTCCTCCGCACCAGGTCCACAAGCTTCTCCTGACCAATGATCTGACGGAAGATGTGCTGGACGAGGCGATAAATATGGAAGCTAATATGATTCTGTCCTATCATCCGCCAGTATTTAAAGCCTTGAAGCGCGTCACCCAGAAAAACTGGAAAGAGAGGTTGGTGGTTAAAGCCCTGGAAAAGCGCCTGGCGATATACTCTCCTCACACATCTTGTGATGCATTGGCAAACGGAGTCAATGACTGGCTGGCCAGGGCTCTAGGGCCAAGCAAGTCTGTGCCACTCCATGCATCTACTTCCCTCACGTATCCTGGTGGCTTTGGGCACCTCTTAGAGTTCAGACTAGATACTGCTGAGAACATCTTCTCCAGGCTGAAATCCATCCAGGGGGTCAGCGTCTGCACCTCCACTGCCAGCCCCGAAGGTCAAAATGTAAGCCTTAGCTGCTCCCAGAATGCATTGGTGGAGGCACTAGCTATCCTATCAGAAGAGCCACATGTGTACAACAGCCTGCAGCTCCTCAGCCTACAGAAACCTCCACTTGTGGACACCGGAATGGGACGTCTCTGCACTCTCCCCTGACCCGGTGTCTATTGCAGCTGCTGTGGAACGCTTTAAAAACACCTGCATCTCCCCTCCTCTCCCCTTGGGCCTTTGGGTAATGGCAAAACCTCTGGAACCCCCCAAATAAAAAATTGGGAACCGGTGGTTGGTGCGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCTTGGTTCAGTGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838346
dbEST ID: 79656048
Trimmed Sequence: CACCACCTGCAGGGGGTCTCGGTCTCTCTGGGACACCACAACTTGCACTTGCCCTTCTAATGCCTGATGGATCTGCCCTCCAAGTTCCTGCAGATACCCTCTCTCAGAGTTGCTATGCTCACACAGGACCACGCTTCGCCCCTCGGCAACAGCATCCAGAACATCGTGATGGGACATCTCACCTGTGAGGTAAAGATCAGCAGGGATACCACCAAGGATACTACTCCCCGACCCTGCACACACAGCTGCCACTCTTACTGAGGATTCCAGAGTTTTGCCACTACCCAAAGCCAAGCGCAGATGAGGGAGATGCAGGTGCTTTTTAATGCGTTCCACAGCAGCTGCAATAGACACCGGTTCAGCGAGAGTGCAGAGACGTCCCATTCCGGTGTCCACAAGTGGAGGCTTCTGTATGCTGAGGAGCTGCAGGCTGTTGTACACATGTGGCTCTTCTGATAGGATAGCTAGTGCCTCCACCAATGCATTCTGGGAGCACCTAACGCTTACATTTTGACCTTCGGGGCCGGCAATGGAGGTGCAGAACCTAACCCCCTGTATGGATTTCCGCCTGCAGAAAAAGTTCTCACACATATCTAGTCCGAAATCGAAAAAGTGCCCCCGGCCCCCAAAGAAAAGATGAAGGAAAGAGAAAAGCGAGGCGAGTGGGAGGGAACAATGAATTATCCCCATACAACCCCAGCCCGGCGCCAGGGCGGTGGGG
Full Trace Sequence: CGGGGAATCTGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACCACCTGCAGGGGGTCTCGGTCTCTCTGGGACACCACAACTTGCACTTGCCCTTCTAATGCCTGATGGATCTGCCCTCCAAGTTCCTGCAGATACCCTCTCTCAGAGTTGCTATGCTCACACAGGACCACGCTTCGCCCCTCGGCAACAGCATCCAGAACATCGTGATGGGACATCTCACCTGTGAGGTAAAGATCAGCAGGGATACCACCAAGGATACTACTCCCCGACCCTGCACACACAGCTGCCACTCTTACTGAGGATTCCAGAGTTTTGCCACTACCCAAAGCCAAGCGCAGATGAGGGAGATGCAGGTGCTTTTTAATGCGTTCCACAGCAGCTGCAATAGACACCGGTTCAGCGAGAGTGCAGAGACGTCCCATTCCGGTGTCCACAAGTGGAGGCTTCTGTATGCTGAGGAGCTGCAGGCTGTTGTACACATGTGGCTCTTCTGATAGGATAGCTAGTGCCTCCACCAATGCATTCTGGGAGCACCTAACGCTTACATTTTGACCTTCGGGGCCGGCAATGGAGGTGCAGAACCTAACCCCCTGTATGGATTTCCGCCTGCAGAAAAAGTTCTCACACATATCTAGTCCGAAATCGAAAAAGTGCCCCCGGCCCCCAAAGAAAAGATGAAGGAAAGAGAAAAGCGAGGCGAGTGGGAGGGAACAATGAATTATCCCCATACAACCCCAGCCCGGCGCCAGGGCGGTGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACCACCTGCAGGGGGTC