ORFeome > ninj1 ORF1 – XORFeome v1.0

ninj1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ninj1
Gene ID: 1027810
Gene Page ID: 959246
ORF Xenbase ID: 17286315

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC153765
Original XGC clone length: 429

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: F09

Sequences - 5ʹ (forward) EST

Accession: JZ839024
dbEST ID: 79656726
Trimmed Sequence: ATGGGGGAATCAGTGGAGCTAAATGGGACAGGGGAGCACTTGGCACTGCGGGATTCAGAGGTCACAGTCAGGAGGCCACTGAATATCAATCATTATGCCAATAAGAAGAGCGTAGCAGAGAGCATGCTGGACGTTGCCTTGCTAATGGCCAATGCCTCACAGATGAAAGCAGTCATTGATCAGGGGCCCAGCTTCTCGTACTATATACCACTCCTCGTTCTGATCTCCATTTCCTTCATTTTGCAGGTCATCGTCGGAATTCTACTCATCTTTATAGTGAAATATGATCTGAACAATCCGGCCAAGCATTATATACTGAACATCCTGGAAAATACAGCCACGGGCCTGGTCTTTATTATAGTGGTCGTTAATGTTCTGATCACGGCGTTTGGAGTTCAGAAACCTGCAGAGACCTCACCGAGTGTCTT
Full Trace Sequence: TCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGGAATCAGTGGAGCTAAATGGGACAGGGGAGCACTTGGCACTGCGGGATTCAGAGGTCACAGTCAGGAGGCCACTGAATATCAATCATTATGCCAATAAGAAGAGCGTAGCAGAGAGCATGCTGGACGTTGCCTTGCTAATGGCCAATGCCTCACAGATGAAAGCAGTCATTGATCAGGGGCCCAGCTTCTCGTACTATATACCACTCCTCGTTCTGATCTCCATTTCCTTCATTTTGCAGGTCATCGTCGGAATTCTACTCATCTTTATAGTGAAATATGATCTGAACAATCCGGCCAAGCATTATATACTGAACATCCTGGAAAATACAGCCACGGGCCTGGTCTTTATTATAGTGGTCGTTAATGTTCTGATCACGGCGTTTGGAGTTCAGAAACCTGCAGAGACCTCACCGAGTGTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAACCTGTAAAAAAAAAAACAAAAAAAACGTGTCTAAAACTATCTGACTGTTACAGGGCCGGGGGGAAAAAAAAGCCCCCCTCCTCAACCCGGCGGTGGGGGTTTGGCTCTGGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACGGGGTCGTGTTTGGTTGTTTGAGAAAAAACGGGGGGGGCGCCCCCCGCCCCCCATCTCCCCCCCCCCGCGGGGGGGGGGGGGGGGGGGGGGGTGGTGTGATATAATATTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGGAATCAGTGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839023
dbEST ID: 79656725
Trimmed Sequence: GACACTCGGTGAGGTCTCTGCAGGTTTCTGAACTCCAAACGCCGTGATCAGAACATTAACGACCACTATAATAAAGACCAGGCCCGTGGCTGTATTTTCCAGGATGTTCAGTATATAATGCTTGGCCGGATTGTTCAGATCATATTTCACTATAAAGATGAGTAGAATTCCGACGATGACCTGCAAAATGAAGGAAATGGAGATCAGAACGAGGAGTGGTATATAGTACGAGAAGCTGGGCCCCTGATCAATGACTGCTTTCATCTGTGAGGCATTGGCCATTAGCAAGGCAACGTCCAGCATGCTCTCTGCTACGCTCTTCTTATTGGCATAATGATTGATATTCAGTGGCCTCCTGACTGTGACCTCTGAATCCCGCAGTGCCAAGTGCTCCCCTGTCCCATTTAGCTCCACTGATTCCCCCATGG
Full Trace Sequence: GGAAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACACTCGGTGAGGTCTCTGCAGGTTTCTGAACTCCAAACGCCGTGATCAGAACATTAACGACCACTATAATAAAGACCAGGCCCGTGGCTGTATTTTCCAGGATGTTCAGTATATAATGCTTGGCCGGATTGTTCAGATCATATTTCACTATAAAGATGAGTAGAATTCCGACGATGACCTGCAAAATGAAGGAAATGGAGATCAGAACGAGGAGTGGTATATAGTACGAGAAGCTGGGCCCCTGATCAATGACTGCTTTCATCTGTGAGGCATTGGCCATTAGCAAGGCAACGTCCAGCATGCTCTCTGCTACGCTCTTCTTATTGGCATAATGATTGATATTCAGTGGCCTCCTGACTGTGACCTCTGAATCCCGCAGTGCCAAGTGCTCCCCTGTCCCATTTAGCTCCACTGATTCCCCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGGCCCAACCTTAAAACAAAAAAGTCGTTATACAACGTCTTTGACCTGGAAAAAGTCCAAANCGGGGATGTACAAGTGTCGTGCCCCCTCAAAGACAGGGGTGGTTGGGGAAAAGAAAAAAGAAGAGAAGGAAAAAAAAGAAGGACAAGAGGAAGAGGAGGGTGTGAGGGGNGGTGAGAAGGAAGAAAAGGGAGAGGGGGGGGGGCCCGCGCGCANAAAGTTGGGAGGAGAGGGGGGTGGNATNTGTGGGTNGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACACTCGGTGAGGTCT