ORFeome > nipal2 ORF4 – XORFeome v1.0

nipal2 ORF4 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nipal2
Gene ID: 6251616
Gene Page ID: 6459548
ORF Xenbase ID: 17286351

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124857
Original XGC clone length: 1059

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ838781
dbEST ID: 79656483
Trimmed Sequence: ATGGCTTTTGTGTCTGACAATAGCACATTGGGACAATATGGTGAATATGGCAATGGCACAAGCATAGGCAACCTGTGGAAAAATGCTCAGCCGGCTGAAATCGTCGGCATTGTTTTGTCAATCTCTGGAAGTTTCTTAATAAGCATCTCTCTTAATCTCCAGAAATACACTCATGTCCGGCTTGCGTGTCAGCAAGACCCTTTACCCTATTACAAAAGCAAGTTATGGTGGTTTGGGATGTTCCTCATGGGAGTCGGGGAGCTTGGAAACTTTACAGCCTATGGCTTTGCCCCAGCTACACTCATTGCACCTCTAGGATGTGTGGCTGTAATAGGAAGTGCTGCTATATCTGTGGTGTTCCTGAAAGAAACCCTGAGGCCGTCCGATATAGTAGGCGGAACCTTGTCAATTGCAGGAACCTACCTCTTACTCACTTTTTCTCCCAATGTATCGGAAGAAATAACCGCCTTGAAAGTGCAGAGATATGTTGTGAGCTGGCCCTTTCTACTTTATTTAATCATAGAAATAATAATCCTTTGTGTCTTGGGGTATTGCCTTAAAAAAAAGAAACGAAACCAAAAGCGGTTTGGCTGCTGCTGGGATCGCTGCTGGCCTCCTTTGACCTCCATTTCTGGTAGATCAGTTTCGGCCGTGCTGGGGGGGAACATTGAGGGAGAAAATGCGGGGTAAGGGAGCCAGACTCTCGTCCCCCTTTTTAGTTGTAAGGGTGGGGGGTGTGGTGGTGTTTGAAGGCCAATTTCGAGGCTAGAGCGCAAACCCCACCAACCACCGGGGGGCTGAAATTGAGGCGGAGAGGTGGGGGG
Full Trace Sequence: TCGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTTTGTGTCTGACAATAGCACATTGGGACAATATGGTGAATATGGCAATGGCACAAGCATAGGCAACCTGTGGAAAAATGCTCAGCCGGCTGAAATCGTCGGCATTGTTTTGTCAATCTCTGGAAGTTTCTTAATAAGCATCTCTCTTAATCTCCAGAAATACACTCATGTCCGGCTTGCGTGTCAGCAAGACCCTTTACCCTATTACAAAAGCAAGTTATGGTGGTTTGGGATGTTCCTCATGGGAGTCGGGGAGCTTGGAAACTTTACAGCCTATGGCTTTGCCCCAGCTACACTCATTGCACCTCTAGGATGTGTGGCTGTAATAGGAAGTGCTGCTATATCTGTGGTGTTCCTGAAAGAAACCCTGAGGCCGTCCGATATAGTAGGCGGAACCTTGTCAATTGCAGGAACCTACCTCTTACTCACTTTTTCTCCCAATGTATCGGAAGAAATAACCGCCTTGAAAGTGCAGAGATATGTTGTGAGCTGGCCCTTTCTACTTTATTTAATCATAGAAATAATAATCCTTTGTGTCTTGGGGTATTGCCTTAAAAAAAAGAAACGAAACCAAAAGCGGTTTGGCTGCTGCTGGGATCGCTGCTGGCCTCCTTTGACCTCCATTTCTGGTAGATCAGTTTCGGCCGTGCTGGGGGGGAACATTGAGGGAGAAAATGCGGGGTAAGGGAGCCAGACTCTCGTCCCCCTTTTTAGTTGTAAGGGTGGGGGGTGTGGTGGTGTTTGAAGGCCAATTTCGAGGCTAGAGCGCAAACCCCACCAACCACCGGGGGGCTGAAATTGAGGCGGAGAGGTGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTTTGTGTCTGACAATAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838780
dbEST ID: 79656482
Trimmed Sequence: ATTCGACATGGTCCCATATGACATTGATTCTGGCTGGATCACATCAACTGTTTTCTTCCCCGGGATTTCACCGATTTTAATAAAGGGCTCTGGAGGCTCACGCTTTTCTTGGTTTTTGGATATCAGGACCACCCCAAAGAAGGACAAAAAACACCCAAAGATAAACATCAAAATATTGAATATGGAAGCACCATCAAATTCCTGGTAAAATATTACTCCTGCAAGTATCGCACTTGTTGTGAAAAATACAAAGTTAATCGGCACCACTTCAGTTGCATTATATAGCTGCATGGCTTGATTTAGGAACTTGACCTGAAATACACAGGACACCACCATTACCACAAACATGACGTAGAATATAGGATAAGTCAGCTGCATTGAACCCTTAAATGTCAGCACCAGCATGCCCGAAACAGCTTTAACAGAAATCACTGTCAATGAAGCCAGCAGCGATACCAGCAGCAGCAAAACCACAATATGGTTCAGTCCCTTTCTTTCAAGGAAATACAGCAAGACACAAAAGATTATTATTTCTATGATCAAATAAAGTAGAGAGGGCCAGCTCAACACATATCTCTGCACTTTCCAGGCGGTTATTTCTTTCAATACATTGGGAGAAAAAGTGAATAAAAAGTTAGTTTCCTGCAATTGAACAAGTTTCCGCCTACTAAATCGGAAGGGCCTCCGGGTTTTCCTTTCGGAAACCCCCACAAAAAATAACCCGCCCCTTCCCCAATAACACCCCCCACCTTCCCTAAAAAAGGTGCAAAT
Full Trace Sequence: GGAAAACTGCTAATGACCATGTAATACGACTCACTATAGGAGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTCGACATGGTCCCATATGACATTGATTCTGGCTGGATCACATCAACTGTTTTCTTCCCCGGGATTTCACCGATTTTAATAAAGGGCTCTGGAGGCTCACGCTTTTCTTGGTTTTTGGATATCAGGACCACCCCAAAGAAGGACAAAAAACACCCAAAGATAAACATCAAAATATTGAATATGGAAGCACCATCAAATTCCTGGTAAAATATTACTCCTGCAAGTATCGCACTTGTTGTGAAAAATACAAAGTTAATCGGCACCACTTCAGTTGCATTATATAGCTGCATGGCTTGATTTAGGAACTTGACCTGAAATACACAGGACACCACCATTACCACAAACATGACGTAGAATATAGGATAAGTCAGCTGCATTGAACCCTTAAATGTCAGCACCAGCATGCCCGAAACAGCTTTAACAGAAATCACTGTCAATGAAGCCAGCAGCGATACCAGCAGCAGCAAAACCACAATATGGTTCAGTCCCTTTCTTTCAAGGAAATACAGCAAGACACAAAAGATTATTATTTCTATGATCAAATAAAGTAGAGAGGGCCAGCTCAACACATATCTCTGCACTTTCCAGGCGGTTATTTCTTTCAATACATTGGGAGAAAAAGTGAATAAAAAGTTAGTTTCCTGCAATTGAACAAGTTTCCGCCTACTAAATCGGAAGGGCCTCCGGGTTTTCCTTTCGGAAACCCCCACAAAAAATAACCCGCCCCTTCCCCAATAACACCCCCCACCTTCCCTAAAAAAGGTGCAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTCGACATGGTCCCATATGA