ORFeome > nipsnap1 ORF1 – XORFeome v1.0

nipsnap1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nipsnap1
Gene ID: 984941
Gene Page ID: 984935
ORF Xenbase ID: 17286369

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC154968
Original XGC clone length: 840

Human orthology & disease relationships

NCBI Entrez ID: 8508
Ensembl gene IDs: ENSG00000184117
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114500,125853,132600,137215,155255,192430,600652,603278,607822,607841,608089

Library Location

Plate ID: GDExl11092
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ839046
dbEST ID: 79656748
Trimmed Sequence: ATGCTGACTCGAGTGATCCGGATTTCTCCTTTGCTCCAAAGCTCTGGGCCCAGCTCGGGATACTTGCCACTGCTGTTATGTAGATATGGCTCCGATTCCAGGGATAGCAGTTGGCTTCGCTCTCTCTTTGTGCGAAAGGTAGATCCTCGCAAAGATGCACATTCCACTTTATTGTCCAAGAAGGAGACAAGTGGTCTCTACAAGATACAGTTTCACAATGTAAAGCCTGAATGCCTGGAAGAATATAATAAACTGACAGAGGAAGTACTGCCCAAGCTACATCATGACCCAGATTACCATTGTGACCTAGTGGGCAATTGGAACACATGGTACGGGGAACAGGACCAGGCAGTTCATTTATGGCGATTCTCCGGGGGTTACCCAGCATTAATGGATTGTATGAATAAGCTGCGCAATAATAAGGAATATCTGGCTTTCCGAGAGGAGAGAAGCCGAATGCTGCTCTCCCGCAAAAACCAACTGCTCCTTGAGTTCAGTTTCTGGAATGAACCTGTGCCACGAAAGGGACCCAACATCTATGAGCTACCTACCTACAAATTAAAGCCAGGAAAAATGATTGAATGGGGAAATGCCGAGGCTCGGGCAATTAGGCATCCTCAGGAAAAACAGAAAACTAGAGGAAGATTCGTCTCTCACCAACGGACTTTGAGGTGGGCAGGCGTGTGGTGGCGTGGGGGGGACGTTGGCCCCGACTAAAAAAAAAAAAAAAAAGCCTTTGTTCCCCCGTCGGGGGAAAAAACAAAAGAGAAAGAAAAAAGGAAAAGCCACTTTCCCGCGGGGAGGAGGAAAGGAGGAGAGGT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGACTCGAGTGATCCGGATTTCTCCTTTGCTCCAAAGCTCTGGGCCCAGCTCGGGATACTTGCCACTGCTGTTATGTAGATATGGCTCCGATTCCAGGGATAGCAGTTGGCTTCGCTCTCTCTTTGTGCGAAAGGTAGATCCTCGCAAAGATGCACATTCCACTTTATTGTCCAAGAAGGAGACAAGTGGTCTCTACAAGATACAGTTTCACAATGTAAAGCCTGAATGCCTGGAAGAATATAATAAACTGACAGAGGAAGTACTGCCCAAGCTACATCATGACCCAGATTACCATTGTGACCTAGTGGGCAATTGGAACACATGGTACGGGGAACAGGACCAGGCAGTTCATTTATGGCGATTCTCCGGGGGTTACCCAGCATTAATGGATTGTATGAATAAGCTGCGCAATAATAAGGAATATCTGGCTTTCCGAGAGGAGAGAAGCCGAATGCTGCTCTCCCGCAAAAACCAACTGCTCCTTGAGTTCAGTTTCTGGAATGAACCTGTGCCACGAAAGGGACCCAACATCTATGAGCTACCTACCTACAAATTAAAGCCAGGAAAAATGATTGAATGGGGAAATGCCGAGGCTCGGGCAATTAGGCATCCTCAGGAAAAACAGAAAACTAGAGGAAGATTCGTCTCTCACCAACGGACTTTGAGGTGGGCAGGCGTGTGGTGGCGTGGGGGGGACGTTGGCCCCGACTAAAAAAAAAAAAAAAAAGCCTTTGTTCCCCCGTCGGGGGAAAAAACAAAAGAGAAAGAAAAAAGGAAAAGCCACTTTCCCGCGGGGAGGAGGAAAGGAGGAGAGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGACTCGAGTGATCCGGATT

Sequences - 3ʹ (reverse) EST

Accession: JZ839045
dbEST ID: 79656747
Trimmed Sequence: CTGCAGGGGAGAGATCTTAAGCGGGATCATGATACGTGACTCCATATTCCTGACAAGTGGAACTGTATAGTATACATTCTCATCCCACCCTCGTTTGGTCCAAGCAGATTTACGTGTCTCCTCTCTGGACTGAAGATCTTTGTAAGCCCACAAATGATGGACCACATACAACTCCCCTATTTGAGAGAAGAATCCTCCTATAGCTTCCTGATTCTCCTGACGATGCTTAATTGCACGAGCCCAGTTATTTCCCCATTCAATCATTGTTCCTGGCTTCAATCTGTAGGTACGTAGCTCATAGATGTTGGGTCCCTTTCGTGGCACAGGTTCATTCCAGAAACTGAACTCAAGGAGCAGCTGGTTTCTGCGGGAGAGCAGCATTCGGCTTCTCTCCTCTCGGAAAGCCAGATATTCCTTATTATTGCGCAGCTTATTCATACAATCCATTAATGCTGGGTAACCCCCGGAGAATCGCCATAAATGAACTGCCTGGTCCTGTTCCCCGTACCATGTGTTCCAATTGCCCACTAGGTCACAATGGTAATCTGGGTCATGATGTAGCTTGGGCAGTACTTCCTCTGTCAGTTTATTATATTCTTCCAGGGCTTTCAGGCTTACATTGTGAAAACGGTATCTGGAAAAAACACTTGTCTCCCTCTTGGAAAATAAATTGGAAAGGTGCATCTTTTGCGAGGAACTACCCTTTTCCCAAAAAAAAAAAAACAAAAACCCAACCGTCTAATTCCCGGGGAA
Full Trace Sequence: GGGCAATATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGCAGGGGAGAGATCTTAAGCGGGATCATGATACGTGACTCCATATTCCTGACAAGTGGAACTGTATAGTATACATTCTCATCCCACCCTCGTTTGGTCCAAGCAGATTTACGTGTCTCCTCTCTGGACTGAAGATCTTTGTAAGCCCACAAATGATGGACCACATACAACTCCCCTATTTGAGAGAAGAATCCTCCTATAGCTTCCTGATTCTCCTGACGATGCTTAATTGCACGAGCCCAGTTATTTCCCCATTCAATCATTGTTCCTGGCTTCAATCTGTAGGTACGTAGCTCATAGATGTTGGGTCCCTTTCGTGGCACAGGTTCATTCCAGAAACTGAACTCAAGGAGCAGCTGGTTTCTGCGGGAGAGCAGCATTCGGCTTCTCTCCTCTCGGAAAGCCAGATATTCCTTATTATTGCGCAGCTTATTCATACAATCCATTAATGCTGGGTAACCCCCGGAGAATCGCCATAAATGAACTGCCTGGTCCTGTTCCCCGTACCATGTGTTCCAATTGCCCACTAGGTCACAATGGTAATCTGGGTCATGATGTAGCTTGGGCAGTACTTCCTCTGTCAGTTTATTATATTCTTCCAGGGCTTTCAGGCTTACATTGTGAAAACGGTATCTGGAAAAAACACTTGTCTCCCTCTTGGAAAATAAATTGGAAAGGTGCATCTTTTGCGAGGAACTACCCTTTTCCCAAAAAAAAAAAAACAAAAACCCAACCGTCTAATTCCCGGGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGCAGGGGAGAGATCTT