ORFeome > nisch ORF1 – XORFeome v1.0

nisch ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nisch
Gene ID: 6255841
Gene Page ID: 5968393
ORF Xenbase ID: 17286387

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC129758
Original XGC clone length: 1395

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: C02

Sequences - 5ʹ (forward) EST

Accession: JZ837845
dbEST ID: 79655547
Trimmed Sequence: ATGGAGGAGAGAGAGCGTCTGAGGTTTGTTTGGACAGTACCACTACCACAGAAAAAGAGCTGGACACAGTCGAGGTGCTAAAAGCAATTCAGAAATCAAAGGATGCAAGGAATAAGCTGGCGACTGGTGATAAGAAGAGATT
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGAGAGAGAGCGTCTGAGGTTTGTTTGGACAGTACCACTACCACAGAAAAAGAGCTGGACACAGTCGAGGTGCTAAAAGCAATTCAGAAATCAAAGGATGCAAGGAATAAGCTGGCGACTGGTGATAAGAAGAGATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGACAAAATAAAAACATTATTTGCAATCCGACTGATATCCCCTATATTGAGTCATATTACACTGGTCATACCTGTTTCCTCGGCTGCTCAGGCCCGTGTCTCCAAAAAACATTTGTTACATACATAAACAGACTGGTTGAGACCTCTCCGGGGTACTTGTCGAAATGTTAAGACTAAAAAGGTTGCCCTTCGGTTGCCCCCGGGGTTGCCGGGAAGACCCCCCCCCGGGAAACATAGGACGGGGCGCTCCCTAGAGTAATTGCGCCTGCGGGGGGGCGCATGCTTTAGTGCAAAACCTTGACCCCCCTCACCGAGCGGAAGCCCAAAGGGGGGCCCTAAGTGGGGTGGTGAGGACGGTGGTAGGTGAGATTATTCATAGACCATCGATTATGAGATTACACAGAGGTCCCCTTTGAGGTCAACGGGAAAGACGAAGCCACAACGTCTGTTCCATTTTGTGCATGCAGTTATTGTTTCTTTTAGGGATTTTACTATAACGCATTTAAGACGGGAGGCCTTGAGCAAATATGCTATATCGAACATATGAAATTTGGGGGGGAGAGTGGTGAAACGGATGAAGCACGAAGTGAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGAGAGAGAGGG

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGCGGTGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTNACTGATANTNACCTGTTCNTTNCAACAAATTNATAANCAATGCTTTCTTATAATGCCAACTTTNTACAAAAAANTTNNCAATCTCTTCTTATCACCANTCNCCANCTTATTCCTTNCATCCTTTNATTTCTTAATTNCTTTTANCACCTCNACTNTCTCCANCTCTTTTTCTATTNTAATNATACTNTCCAAACAAACCTCAAACACTCTCTCTCCTCCATNCTCCCAACTTTTTTNTACAAANTTTTCATTATAAAAAAACATTNCTCATCAATTTATTACAACNAACANNTCACTATCAATCAAAATAAAATCATTATTTACCACCCAACCTTAATACTCTCCATCNTTTTCAAAAAACAATCACTANAAAAAAAACCATCACCATCTNNNACTAACCNCCATTATATAACCCTAACATCCATCCAATACACCNAACCCTCTATTACACNACTTNNAACCNTTAAAAAAACCCNNTNAAANNNAAAAAAAACCCCTCTCNNNTTAAAAAAAAANCTNNAANAAACCNAAANNAAANNNNNNAAANNANANAACCTTNNACNNANNNNNNNNNNNNNNANNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAANNNNNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAANNANNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNANNNNNNNNNNAANNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNANNANAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNANNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAANNNNNNNNNNNNANNNANNANNNNNNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTCTTCTTATCACCAGTCGCCA