ORFeome > nit1 ORF1 – XORFeome v1.0

nit1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: nit1
Gene ID: 975431
Gene Page ID: 975427
ORF Xenbase ID: 17286393

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC078575
Original XGC clone length: 867

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ839890
dbEST ID: 79657592
Trimmed Sequence: ATGGCTGGTGCCCACAAGCCCCTGATTGCCGTGTGCCAGATGACTTCAACCTCTGATAAGGAGAAGAATTTCGCCACGTGTTCGCGGCTGATCCGGGAGGCTGCGGGGCGTCGCGCTTGCATGGTGTTTCTTCCGGAAGCCTTTGATTATATCGGGGGCAGCACCGAGGAGACGCTGAGTCTGGCTGAGTCTCTACATGGGGACACCATTCAGCGTTACACCCAACTCGCCAGGGAGTGTGGGCTCTGGCTTTCCCTGGGGGGATTTCATGAGAAAGGACCCAACTGGGACACGGACCAACGCATTTCCAATTCTCACGTGGTTGTGGACAACACAGGGCACATAGTATCGGTGTACCGCAAGGCTCACCTGTTTGACGTAGACTTGCAGAATGGAGTGTCACTCAGAGAGAGCAGTTCCACCCTCCCCGGAGCAGAGCTTATTCGCCCCATCACTTCTCCAGCAGGAAAGATTGGCCTGGGGGTGTGTTACGACCTCCGCTTCCCAGAATTCTCCTTGGCTCTGGCCCAACAAGGAGCAGAACTTCTCACTTACCCTTCTGCCTTCACCCTCACTACTGGTCTGGCACATTGGGAGGTGTTGCTGAGAGCCCGTGCCATAAAAACCCAGTGCTACGTAGTTGCACCGGCACAGACAGACCAACAACATGAAAAAAAGGAAGTCCCAATGTCCCCCTTTGGGTGGTTGACCCCTGGGGGGCTGGGTCTTTTGCCCAATGCCCAGGGAAAGAAAAAGGAAAATATGTTTTTGGTCTTAAAAATTTAAAATTTCCCCCAAACATTGGAAACCC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGGTGCCCACAAGCCCCTGATTGCCGTGTGCCAGATGACTTCAACCTCTGATAAGGAGAAGAATTTCGCCACGTGTTCGCGGCTGATCCGGGAGGCTGCGGGGCGTCGCGCTTGCATGGTGTTTCTTCCGGAAGCCTTTGATTATATCGGGGGCAGCACCGAGGAGACGCTGAGTCTGGCTGAGTCTCTACATGGGGACACCATTCAGCGTTACACCCAACTCGCCAGGGAGTGTGGGCTCTGGCTTTCCCTGGGGGGATTTCATGAGAAAGGACCCAACTGGGACACGGACCAACGCATTTCCAATTCTCACGTGGTTGTGGACAACACAGGGCACATAGTATCGGTGTACCGCAAGGCTCACCTGTTTGACGTAGACTTGCAGAATGGAGTGTCACTCAGAGAGAGCAGTTCCACCCTCCCCGGAGCAGAGCTTATTCGCCCCATCACTTCTCCAGCAGGAAAGATTGGCCTGGGGGTGTGTTACGACCTCCGCTTCCCAGAATTCTCCTTGGCTCTGGCCCAACAAGGAGCAGAACTTCTCACTTACCCTTCTGCCTTCACCCTCACTACTGGTCTGGCACATTGGGAGGTGTTGCTGAGAGCCCGTGCCATAAAAACCCAGTGCTACGTAGTTGCACCGGCACAGACAGACCAACAACATGAAAAAAAGGAAGTCCCAATGTCCCCCTTTGGGTGGTTGACCCCTGGGGGGCTGGGTCTTTTGCCCAATGCCCAGGGAAAGAAAAAGGAAAATATGTTTTTGGTCTTAAAAATTTAAAATTTCCCCCAAACATTGGAAACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGTGCCCACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839889
dbEST ID: 79657591
Trimmed Sequence: GTCGGGTTTATTAAAGGAGATTTTCCCATACAGATCAGTCCTGCGGTGCCTCCACACCGGCATGTCACGCCTCACACGCTCCATGTAGGGAATGTCAATCTCAGCATAACATATTCCTGTTCCTCCCTGGCATTGGCCAATGACCAGCCCCCACGGGTCTACCACCATAGCGTGACCATAGGACGTCCTCTTCTCATTGTGTCTGTCTGTCTGTGCCGCTGCAACTACGTAGCACTGGGTTTCTATGGCACGGGCTCTCAGCAACACCTCCCAATGTGCCAGACCAGTAGTGAGGGTGAAGGCAGAAGGGTAAGTGAGAAGTTCTGCTCCTTGTTGGGCCAGAGCCAAGGAGAATTCTGGGAAGCGGAGGTCGTAACACACCCCCAGGCCAATCTTTCCTGCTGGAGAAGTGATGGGGCGAATAAGCTCTGCTCCGGGGAGGGTGGAACTGCTCTCTCTGAGTGACACTCCATTCTGCAAGTCTACGTCAAACAGGTGAGCCTTGCGGTACACCGATACTATGTGCCCTGTGTTGTCCACAACCACGTGAGAATTGGAAATGCGTTGGTCCGTGTCCCAGTTGGGGTCCTTTCTCATGAAATCCCCCCAGGGAAAGCCAGAGCCCACACTCCCCTGGCCAATTGGGTGTAACCCCTGAATGGTGTCCCCATGTAGAGACTCAGCCAGACTCACCGTCTCCTCGGTGCTGCCCCCCAATTTTATCAAAAGGCTTCCGAAAGAAAACCCCATGCCAGCCGCCCACCCCC
Full Trace Sequence: GCGGTAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCGGGTTTATTAAAGGAGATTTTCCCATACAGATCAGTCCTGCGGTGCCTCCACACCGGCATGTCACGCCTCACACGCTCCATGTAGGGAATGTCAATCTCAGCATAACATATTCCTGTTCCTCCCTGGCATTGGCCAATGACCAGCCCCCACGGGTCTACCACCATAGCGTGACCATAGGACGTCCTCTTCTCATTGTGTCTGTCTGTCTGTGCCGCTGCAACTACGTAGCACTGGGTTTCTATGGCACGGGCTCTCAGCAACACCTCCCAATGTGCCAGACCAGTAGTGAGGGTGAAGGCAGAAGGGTAAGTGAGAAGTTCTGCTCCTTGTTGGGCCAGAGCCAAGGAGAATTCTGGGAAGCGGAGGTCGTAACACACCCCCAGGCCAATCTTTCCTGCTGGAGAAGTGATGGGGCGAATAAGCTCTGCTCCGGGGAGGGTGGAACTGCTCTCTCTGAGTGACACTCCATTCTGCAAGTCTACGTCAAACAGGTGAGCCTTGCGGTACACCGATACTATGTGCCCTGTGTTGTCCACAACCACGTGAGAATTGGAAATGCGTTGGTCCGTGTCCCAGTTGGGGTCCTTTCTCATGAAATCCCCCCAGGGAAAGCCAGAGCCCACACTCCCCTGGCCAATTGGGTGTAACCCCTGAATGGTGTCCCCATGTAGAGACTCAGCCAGACTCACCGTCTCCTCGGTGCTGCCCCCCAATTTTATCAAAAGGCTTCCGAAAGAAAACCCCATGCCAGCCGCCCACCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCGGGTTTATTAAAGGAGATTTT