ORFeome > nkain1 ORF1 – XORFeome v1.0

nkain1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: nkain1
Gene ID: 946564
Gene Page ID: 946557
ORF Xenbase ID: 17286405

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078514
Original XGC clone length: 624

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ839934
dbEST ID: 79657636
Trimmed Sequence: ATGGGCAGATGCAGTGGGCGATGTACCTTGGTTGGGATCTGTTGCCTACAGCTGGCTGCTGCCTTGCAGAGACAAATCTTTGACTTCCTTGGTTATCAATGGGCTCCCATATTAGCAAACTTCCTTCATATTATGGTGGTGATTCTGGGAATACTGGGGACTCTTCATTACAGATCCAGGTATCTTATACTGTATTCCATATGGTTGGCATTATGGGTGGCCTGGAATGCATTTATTATATGTTTCTATCTGGAAGTGGGGCATTTCTCACAGCACAGGGACCTGATCATGAACTTTAATACCTCCATGCATCGGTCTTGGTGGATGGAGAATGGGCCAGGCTGCTTGGTGACCCCTGTGCGTGGCCCTCCTCTATCACTGGCAGATCACCACATGGTGACAGTGACTGGTTGTCTCCTCGATTATCCATACATAGAAGCTTTAAGTAGTGCTCTGCAAATCTTCCTGGCGCTCTTTGGTTTTGTCTATGCTTGCTATGTCAGCAAAGTTTTCATGGATGAAGAAGACAGCTTTGATTTCATTGGTTCTTATGATTCCTATGGATATCAGGCTCCTATGAAGACATCACACCTCCGTGTGCAGCCACTGTACAAACCTGGTTT
Full Trace Sequence: GGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCAGATGCAGTGGGCGATGTACCTTGGTTGGGATCTGTTGCCTACAGCTGGCTGCTGCCTTGCAGAGACAAATCTTTGACTTCCTTGGTTATCAATGGGCTCCCATATTAGCAAACTTCCTTCATATTATGGTGGTGATTCTGGGAATACTGGGGACTCTTCATTACAGATCCAGGTATCTTATACTGTATTCCATATGGTTGGCATTATGGGTGGCCTGGAATGCATTTATTATATGTTTCTATCTGGAAGTGGGGCATTTCTCACAGCACAGGGACCTGATCATGAACTTTAATACCTCCATGCATCGGTCTTGGTGGATGGAGAATGGGCCAGGCTGCTTGGTGACCCCTGTGCGTGGCCCTCCTCTATCACTGGCAGATCACCACATGGTGACAGTGACTGGTTGTCTCCTCGATTATCCATACATAGAAGCTTTAAGTAGTGCTCTGCAAATCTTCCTGGCGCTCTTTGGTTTTGTCTATGCTTGCTATGTCAGCAAAGTTTTCATGGATGAAGAAGACAGCTTTGATTTCATTGGTTCTTATGATTCCTATGGATATCAGGCTCCTATGAAGACATCACACCTCCGTGTGCAGCCACTGTACAAACCTGGTTTGCCAACTTTTCTTGTACAAGTTGGCATTATAAAAAAACATTGCTTATCATTTTTTTGCAACGAAACAGGTTACTATTCATTCCAAAATAAATTCATTAATTTCCCATCCACCCTTAAAATCCCCCTAAAAAAAAAATAAAAAAAAAAATAAATAAAAAAAATTTTTTTCCCGGGCACACCCTCCGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCAGATGCAGTGGGCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839933
dbEST ID: 79657635
Trimmed Sequence: ACCAGGCTTGTACAGTGGCTGCAGCTGGAGGTGTGATGTCTTCATAGGAGCCTGATATCCATAGGAATCATAAGAACCAATGAAATCAAAGCTGTCTTCTTCATCCATGAAAACTTTGCTGACATAGCAAGCATAGACAAAACCAAAGAGCGCCAGGAAGATTTGCAGAGCACTACTTAAAGCTTCTATGTATGGATAATCGAGGAGACAACCAGTCACTGTCACCATGTGGTGATCTGCCAGTGATAGAGGAGGGCCACGCACAGGGGTCACCAAGCAGCCTGGCCCATTCTCCATCCACCAAGACCGATGCATGGAGGTATTAAAGTTCATGATCAGGTCCCTGTGCTGTGAGAAATGCCCCACTTCCAGATAGAAACATATAATAAATGCATTCCAGGCCACCCATAATGCCAACCATATGGAATACAGTATAAGATACCTGGATCTGTAATGAAGAGTCCCCAGTATTCCCCGAATCACCACCATAATATGAAAGGAAGTTTGCTAATATGGGAGCCCATTGATAACAAGGGAAGTCAAAAATTTGTCTCTTCAAGGCAGCCGCCAGCTGTAAGCCACAAATCCCAACCAAGGTACATCGCCCACTGGCATCTGCCAATGTGGC
Full Trace Sequence: GAAAACAGCTATTGACCATGTAATACGACTCACTATAGAGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCAGGCTTGTACAGTGGCTGCAGCTGGAGGTGTGATGTCTTCATAGGAGCCTGATATCCATAGGAATCATAAGAACCAATGAAATCAAAGCTGTCTTCTTCATCCATGAAAACTTTGCTGACATAGCAAGCATAGACAAAACCAAAGAGCGCCAGGAAGATTTGCAGAGCACTACTTAAAGCTTCTATGTATGGATAATCGAGGAGACAACCAGTCACTGTCACCATGTGGTGATCTGCCAGTGATAGAGGAGGGCCACGCACAGGGGTCACCAAGCAGCCTGGCCCATTCTCCATCCACCAAGACCGATGCATGGAGGTATTAAAGTTCATGATCAGGTCCCTGTGCTGTGAGAAATGCCCCACTTCCAGATAGAAACATATAATAAATGCATTCCAGGCCACCCATAATGCCAACCATATGGAATACAGTATAAGATACCTGGATCTGTAATGAAGAGTCCCCAGTATTCCCCGAATCACCACCATAATATGAAAGGAAGTTTGCTAATATGGGAGCCCATTGATAACAAGGGAAGTCAAAAATTTGTCTCTTCAAGGCAGCCGCCAGCTGTAAGCCACAAATCCCAACCAAGGTACATCGCCCACTGGCATCTGCCAATGTGGCCAACTTTTTTTGTACAAATTTTGGCATAATAAAAAACCATTGGCTCATCAATTTGTTTGCAACCAAACAGGTTCACTTATCACTTCAAAAAAAAAAATCATTATATTTGGAGGGCCCCAAACCTTAAAAAAATGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCAGGCTTGTACAGTGGCT