ORFeome > nkain3 ORF1 – XORFeome v1.0

nkain3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: nkain3
Gene ID: 5816267
Gene Page ID: 5816250
ORF Xenbase ID: 17286411

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078500
Original XGC clone length: 540

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: JZ839720
dbEST ID: 79657422
Trimmed Sequence: ATGGGATGTTGTACAGGGCGCTGCACTTTGGTTTTCATCTGCACTTTACAGATGTTGGTTGCACTGGAAAGACAGATATTTGATTTCCTTGGATACCAATGGGCACCGATTCTTGGGAATTTTCTTCACATCATTGTCGTCATATTGGGATTATTTGGAACTATACAGTACAGGCCGAGATACATAGTGGCGTACACAATTTGGACAGCTTTCTGGGTTGCCTGGAATGTCTTTATCATCTGTTTCTACTTGGAAGTTGGTGGACTCTCTAAGGACACTGATCTCATGACCTTCAATATCTCCATCCATCGTTCATGGTGGCGAGAACATGGACCGGGCTGTGTGTGGAGGCTTGTGCCTGCTCCGCCAAGCAAGAATCTGGGAGATCACTCGTTTATATCTGTGACGGGATGCATCATACAATATCAGTACCTCGAGGTCATCCACAGTGCCGTCCAAATACTTCTCTCTCTAATTGGATTTGTGTATGCTTGCTACGTGATCAGCGTTATCACAGATGAAGAGGACAGCTCGACATT
Full Trace Sequence: TCGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGATGTTGTACAGGGCGCTGCACTTTGGTTTTCATCTGCACTTTACAGATGTTGGTTGCACTGGAAAGACAGATATTTGATTTCCTTGGATACCAATGGGCACCGATTCTTGGGAATTTTCTTCACATCATTGTCGTCATATTGGGATTATTTGGAACTATACAGTACAGGCCGAGATACATAGTGGCGTACACAATTTGGACAGCTTTCTGGGTTGCCTGGAATGTCTTTATCATCTGTTTCTACTTGGAAGTTGGTGGACTCTCTAAGGACACTGATCTCATGACCTTCAATATCTCCATCCATCGTTCATGGTGGCGAGAACATGGACCGGGCTGTGTGTGGAGGCTTGTGCCTGCTCCGCCAAGCAAGAATCTGGGAGATCACTCGTTTATATCTGTGACGGGATGCATCATACAATATCAGTACCTCGAGGTCATCCACAGTGCCGTCCAAATACTTCTCTCTCTAATTGGATTTGTGTATGCTTGCTACGTGATCAGCGTTATCACAGATGAAGAGGACAGCTCGACATTGCCAACTTTCTTGTACAAAGTTGGCATTATGAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCAATACTGAGTCGTAATAAATGGGTCAAAACTAAAAAAAAAAAAAACATGACCCATGTCTAAAATACCTTAAAAGTAAAAAAAAAAAACAAAAAAAAAAGCCCATCTCCATTTTCTCGAAGAAAGCGGTGGGGGGCAAAAATGCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGATGTTGTACAGGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839719
dbEST ID: 79657421
Trimmed Sequence: TGTCGAGCTGTCCTCTTCATCTGTGATAACGCTGATCACGTAGCAAGCATACACAAATCCAATTAGAGAGAGAAGTATTTGGACGGCACTGTGGATGACCTCGAGGTACTGATATTCTATGATGCATCCCGTCACAGATATAAACGAGTGATCTCCCAGATTCTTGCTTGGCGGAGCAGGCACAAGCCTCCACACACAGCCCGGTCCATGTTCTCGCCACCATGAACGATGGATGGAGATATTGAAGGTCATGAGATCAGTGTCCTTAGAGAGTCCACCAACTTCCAAGTAGAAACAGATGATAAAGACATTCCAGGCAACCCAGAAAGCTGTCCAAATTGTGTACGCCACTATGTATCTCGGCCTGTACTGTATAGTTCCAAATAATCCCAATATGACGACAATGATGTGAAGAAAATTCCCAAGAATCGGTGCCCATTGGTATCCAAGGAAATCAAATATCTGTCTTTCCAGTGCAACCAACATCTGTAAAGTGCAGATGAAAACCAAAGTGCAGCGCCCTGTACAACATCCCATGG
Full Trace Sequence: GAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTCGAGCTGTCCTCTTCATCTGTGATAACGCTGATCACGTAGCAAGCATACACAAATCCAATTAGAGAGAGAAGTATTTGGACGGCACTGTGGATGACCTCGAGGTACTGATATTCTATGATGCATCCCGTCACAGATATAAACGAGTGATCTCCCAGATTCTTGCTTGGCGGAGCAGGCACAAGCCTCCACACACAGCCCGGTCCATGTTCTCGCCACCATGAACGATGGATGGAGATATTGAAGGTCATGAGATCAGTGTCCTTAGAGAGTCCACCAACTTCCAAGTAGAAACAGATGATAAAGACATTCCAGGCAACCCAGAAAGCTGTCCAAATTGTGTACGCCACTATGTATCTCGGCCTGTACTGTATAGTTCCAAATAATCCCAATATGACGACAATGATGTGAAGAAAATTCCCAAGAATCGGTGCCCATTGGTATCCAAGGAAATCAAATATCTGTCTTTCCAGTGCAACCAACATCTGTAAAGTGCAGATGAAAACCAAAGTGCAGCGCCCTGTACAACATCCCATGGTGCCAACTTTTTTGTACCAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCCATTTATTGGCGGCCAAAAACTAACAAAAGAACAATCGTTTAAAGGGCGCGGGGGAACTGGGGAAAAAAAAAAAAAAAAAAAAGANNGCCACTTTTCTTNTNGTCCTTCCTTTTNTTGGTGAGGGGGGGGGGGGGNAAAAGAAGAGAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTCGAGCTGTCCTCTTCATCTGT